View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_228 (Length: 252)
Name: NF10261A_low_228
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_228 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 4705715 - 4705965
Alignment:
| Q |
1 |
tcattgtctttcaaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705715 |
tcattgtctttcgaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa |
4705814 |
T |
 |
| Q |
101 |
aatgttgagatttacaataccgtttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgatttgc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4705815 |
aatgttgagatttacaataccttttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgttttgc |
4705914 |
T |
 |
| Q |
201 |
tattagttatggtgtatgaattgatctatgaggcactaacaccaaactcga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4705915 |
tattagttatggtgtatgaattgatctatgaggcactcacaccaaactcga |
4705965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University