View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_234 (Length: 251)
Name: NF10261A_low_234
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_234 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 22 - 251
Target Start/End: Complemental strand, 44736063 - 44735834
Alignment:
| Q |
22 |
tcataaattgtgatggaaagacaatgaacaagctgctactagaggttggctgtttgataccttttgttctcattcaaatgttggttctagagagcagata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44736063 |
tcataaattgtgatggaaagacaatgaacaagctgctactagaggttggctgtttgataccttttgttctcattcaaatgttggttctagagagcagata |
44735964 |
T |
|
| Q |
122 |
tttttcttgaaagattaccaatttacttcatgattatattgcataatgatctcaattttcaactcatattgacctcagcctgtaattttatcgggtcttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44735963 |
tttttcttgaaagattaccaatttacttcatgattatattgcataatgatctcaattttcaactcatattgacctcagcctgtaattttattgggtcttg |
44735864 |
T |
|
| Q |
222 |
attgtcttttgagctcctttattttgtaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44735863 |
attgtcttttgagctcctttattttgtaat |
44735834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University