View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_252 (Length: 250)
Name: NF10261A_low_252
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_252 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 28182642 - 28182878
Alignment:
| Q |
14 |
gatggacatcaatcgttgtagagaggttggcatcattcatcatttggaggtcttggctgcaactgttttggtgctacatgcaattgaggagtcaggaagt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182642 |
gatgcacatcaatcgttgtagagaggttggcatcattcatcatttggaggtcttggctgcaactgttttggtgctacatgcaattgaggagtcaggaagt |
28182741 |
T |
|
| Q |
114 |
aactcacaaatatatatatcctgactttccagagattctaatccatcttttgatcttacaagttactgttccatggttgattattttcatttgaaacaaa |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28182742 |
aactcacaaatatatatatcatgactttccagagattctaatccatcttttgatcttacaagttactgttccatggttgattattttcatttgaaacaaa |
28182841 |
T |
|
| Q |
214 |
acttgtaactcctgttgtataaataaatcaatcttat |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28182842 |
acttggaactcctgttgtataaataaatcaatcttat |
28182878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University