View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_253 (Length: 250)
Name: NF10261A_low_253
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_253 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 164331 - 164106
Alignment:
| Q |
13 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggggattcgttatgttcctacttgtatgtatttgctcctaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
164331 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
164232 |
T |
|
| Q |
113 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164231 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
164132 |
T |
|
| Q |
213 |
gcataacaacgaacttgatccatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
164131 |
gcataacaacgaacttgatccatatt |
164106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University