View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_257 (Length: 249)
Name: NF10261A_low_257
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_257 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 28 - 249
Target Start/End: Original strand, 31170887 - 31171108
Alignment:
| Q |
28 |
agtatgaaaagttaaaaagcaagtgatatttgctcaaaattgtttgtcataaattagtagccattgagcagaaaggnnnnnnntacgacattatgaaatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
31170887 |
agtatgaaaagttaaaaagcaagtgatatttgctcaaaattgtttgtcataaattagtagccatcgagcagaaagggaaaaaatacgacattatgaaatt |
31170986 |
T |
|
| Q |
128 |
atcttacgaacagagatcttaaggagggaaaaggaagaaataaacttttatgactttggccttacattgactctttctatacggcgcatttcgtcttcaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31170987 |
atcttacgaacagagatcttaaggagggaaaaggaagaaataaacttttatgactttggccttacattgactctttctatacggcgcatttcgtcttcaa |
31171086 |
T |
|
| Q |
228 |
gtaatgatagttgtgcagctga |
249 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31171087 |
gtaatgatagttgtgcagctga |
31171108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 246
Target Start/End: Original strand, 35224424 - 35224485
Alignment:
| Q |
185 |
ggccttacattgactctttctatacggcgcatttcgtcttcaagtaatgatagttgtgcagc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
35224424 |
ggccttacattgactctttctatacggcgcatttcatcttcgagtaatgatagctgtgcagc |
35224485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University