View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_260 (Length: 249)
Name: NF10261A_low_260
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_260 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 17261332 - 17261556
Alignment:
| Q |
15 |
tggacatcatgcatcttagtttgcataataggctttatattacaattaatgttactattgctagctcttagatatttggcacatataagatcgtgaaaga |
114 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17261332 |
tggacattatgcatcttagtttgcatcataggctttatattacaat----gttactattgctagctcttagatatttggcacatataagatcgtgaaaga |
17261427 |
T |
|
| Q |
115 |
tgtggttattataacccataccaattcaaacaataaaagatattgctacaccatatcgaccgcatttattaccggctgaaaatacaggctaacaacatcg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| || ||||||||| |
|
|
| T |
17261428 |
tgtggttattataacccataccaattcaaacaataaaagatattgctacaccatatcgaccgcatttattacctgttgaaaatacagcct-acaacatcg |
17261526 |
T |
|
| Q |
215 |
tcgtctcagtgcgtcgttgtgatgtccatc |
244 |
Q |
| |
|
||||||| ||||||||||||||||| |||| |
|
|
| T |
17261527 |
tcgtctcggtgcgtcgttgtgatgttcatc |
17261556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University