View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_265 (Length: 248)
Name: NF10261A_low_265
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_265 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 138
Target Start/End: Original strand, 37372175 - 37372304
Alignment:
| Q |
9 |
atgagatggacatcactcaagaccgcaccaaaataatgttatgtacatacaaaacctataaattttgcattaaggaaataaatgagatggatggtagtca |
108 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37372175 |
atgacatggacctcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtca |
37372274 |
T |
|
| Q |
109 |
aattaacagtggcaagtggagatttaggaa |
138 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
37372275 |
aattactagtggcaagtggagatttaggaa |
37372304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 157 - 248
Target Start/End: Original strand, 37372290 - 37372382
Alignment:
| Q |
157 |
gtggagatttaggaaaactacaagagaaaatattataaaa-ttttagagattgatgagttcgagaatgatgtgatatatgacataatattata |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37372290 |
gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgagagtgatgtgatatatgacataatattata |
37372382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University