View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_283 (Length: 246)
Name: NF10261A_low_283
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_283 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 31525430 - 31525199
Alignment:
| Q |
11 |
gacatcactgattttttctgtcttttatatcatccccatcagtatccatgttttttgaaacacaaacaaaatcttgtttgtttattattttggccacatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31525430 |
gacatcactgattttttctgtcttttatatcatccccatcagtatccatgttttttgaaacacaaacaaaatcttgtttgtttattattttggccacatg |
31525331 |
T |
|
| Q |
111 |
agacaatgcattataagacgaaccaccctgtaacaaagctttctcggcactaaccctaacctctttcactctttccctcacgtggtttctcttcccattt |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31525330 |
agacaatgcgttataagacgaaccaccctgtaacaaagctttctctgcactaaccctaacctctttcactctttccctcacgtggtttctcttcccattt |
31525231 |
T |
|
| Q |
211 |
tggtccaccaaaattacttttctcaccaaact |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
31525230 |
tggtccaccaaaattacctttctcaccaaact |
31525199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University