View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_284 (Length: 246)
Name: NF10261A_low_284
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_284 |
 | |
|
| [»] scaffold0246 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 51254302 - 51254534
Alignment:
| Q |
8 |
actctcactacagttctagggttaccgttaagacaatccacgtacgaagccctatccaatgccattccgatgaatcccttccaatcctcaccggggctat |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
51254302 |
actctcactacatttctagggttaccgttaagacaatccacgtacgaagccctatccaatgccattccgatgaatcccttccaatcctcaccggagccat |
51254401 |
T |
|
| Q |
108 |
gcaactgttgcggcttcacaccgacaacctctctcttcctccacactatcacctacagagccatcaaccgtcgtttctgcacaaactgcgttctcaaaca |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51254402 |
gcgactgttgcggcttcacaccgacaacctctctcttcctccacactatcacctacagagccatcaaccgtcgtttctgcacaaactgcgttctcaaaca |
51254501 |
T |
|
| Q |
208 |
acaacaaggcactttttgccctatattcttcga |
240 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| |
|
|
| T |
51254502 |
acaacaaggcactttttgccctatttgcttcga |
51254534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 133 - 231
Target Start/End: Original strand, 11764 - 11863
Alignment:
| Q |
133 |
aacctctctcttcctccacactatcacctacagagccatcaaccgt-cgtttctgcacaaactgcgttctcaaacaacaacaaggcactttttgccctat |
231 |
Q |
| |
|
|||||||||| |||||||| | |||||| ||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||| || |||||| |
|
|
| T |
11764 |
aacctctctcatcctccacgccatcaccaacagagccatcaaatgttcgtttctgcacaaattgcgttctcaaacaacaacaaggcacttctttccctat |
11863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University