View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_289 (Length: 245)
Name: NF10261A_low_289
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_289 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 44 - 235
Target Start/End: Original strand, 11364937 - 11365128
Alignment:
| Q |
44 |
gtagaaaatgatttgcttgacaaggtatatcttgtactctattaacatttaattttggtgagtttttgttacctgaaacaacagtacattggtcattctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11364937 |
gtagaaaatgatttgcttgacaaggtatatcttgtactctattaacatttaattttggtgagtttttgttacctgaaacaacagtagattggtcattctt |
11365036 |
T |
|
| Q |
144 |
tttaaactgctcaatatctttgcatcacataaacatattttacatcttagcattgtcatttcatttcccctttgcaactttaggttaatatt |
235 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11365037 |
tttaaactgctgcatatctttgcatcacataaacatattttacatcttagcattgtcatttcatttcccctttgcaactttaggttaatatt |
11365128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University