View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_290 (Length: 245)
Name: NF10261A_low_290
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_290 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 33026416 - 33026194
Alignment:
| Q |
23 |
ttcttaccttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcaaactgtctttgcatgacagatggaaatgttcttga |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
33026416 |
ttcttaacttcggtgtgtcaatctcgaacacaggtctcttctgattcacaatcttttgattctcagactgtttttgcatgacagatggaaatgttcttga |
33026317 |
T |
|
| Q |
123 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcgtagaacacgaagaatcagaaagtttgtcatac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33026316 |
aggggattgttctaatcccatcaactttgcaacaagattggtacttttttccttccttggaaaagtcggtgaacacgaagaatcagaaagtttgtcatac |
33026217 |
T |
|
| Q |
223 |
caaacaacagatgattggcttga |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33026216 |
caaacaacagatgattggcttga |
33026194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University