View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_291 (Length: 245)
Name: NF10261A_low_291
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_291 |
 | |
|
| [»] scaffold0175 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0175 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 24771 - 24540
Alignment:
| Q |
12 |
tgttgaggttgcagctgctgatctgcgtgtgattttaaatgctcgtatgtttggcactcatgccaaccattctgtttctcaacctgaagaggcacagacg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24771 |
tgttgaggttgcagctgctgatctgcgtgtgattttaaatgctcgtatgtttgacactcatgccaaccattctgtttctcaacctgaagaggcacagatg |
24672 |
T |
|
| Q |
112 |
gaaattgttttccagggaagggaaagctgaccgtcccactaaatccattgttactgactttatgagaatttgattgagagtaagccagaggcccagtggg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24671 |
gaaattgttttccagggaagggaaagctgaccgtcccactaaatccattgttactgactttatgagaatttgattgagagtaagccagaggcccagtggg |
24572 |
T |
|
| Q |
212 |
gcctaaatcattagatgatgaatccaaatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24571 |
gcctaaatcattagatgatgaatccaaatgat |
24540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University