View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_294 (Length: 244)
Name: NF10261A_low_294
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_294 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 1329433 - 1329663
Alignment:
| Q |
10 |
aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagcagttagaggttatggaagagtttatcaaagataagaaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329433 |
aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca |
1329532 |
T |
|
| Q |
110 |
tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329533 |
tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa |
1329632 |
T |
|
| Q |
210 |
tgaagtcaaggcccttccaccaccagaggaa |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
1329633 |
tgcagtcaaggcccttccaccaccagaggaa |
1329663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University