View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_296 (Length: 244)
Name: NF10261A_low_296
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_296 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 43365778 - 43365555
Alignment:
| Q |
21 |
catacatctttctggaaagacaacaggtctgtgtttacaatttacttctatcatatcaggaagaatgtctcttaaatcacatataatattttctttggta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43365778 |
catacatctttctggaaagacaacaggtctgtgtttacaatttacttctatcatatcaggaagaatgtctcttaaatcacatataatattttctttggta |
43365679 |
T |
 |
| Q |
121 |
gcagaacacattttcattgtaccccttaatttgtaagtaatatttgattattattttcttgcagcaatttttctcaattatttgatgccgattggtttat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43365678 |
gcagaacacattttcattgtaccccttaatttgtaagtaatatttgattattattttcttgcagcaatttttctcaattatttgatgccgattggtttat |
43365579 |
T |
 |
| Q |
221 |
aacatccctccggaatgacataag |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43365578 |
aacatccctccggaatgacataag |
43365555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University