View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_300 (Length: 244)
Name: NF10261A_low_300
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_300 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 237
Target Start/End: Complemental strand, 28411322 - 28411087
Alignment:
| Q |
2 |
ttggtgttagtattttagtattctgtcctggtattccataatccgatttctcgtgaagtaattgttgataacaatcttgttctgcatacatctatctctt |
101 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28411322 |
ttggtattagtattttagtattctgtcctggtattccataatccgatttctcgtgaagtaattgtcgataacaatcttgttctgcatacatctatctctt |
28411223 |
T |
|
| Q |
102 |
gctagtatttcctgctcaatgtggctctctcatatatgtcatcgtctgacatcgatacatgcggttatactcaaatatttccactttttcaaattattac |
201 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28411222 |
gctagtatttcctgctcaatgtagcactctcatatatgtcatcgtctgacatcgatacatgcggttatactcaaatatttccactttttcaaattattac |
28411123 |
T |
|
| Q |
202 |
cagcaaccacatatcagtgtcatgtctgatgtccat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28411122 |
cagcaaccacatatcagtgtcatgtctgatgtccat |
28411087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University