View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_307 (Length: 243)
Name: NF10261A_low_307
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_307 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 9165802 - 9165589
Alignment:
| Q |
19 |
gatgtaaatcacccaaacaagttgttgaaaatatcaatcaatttgtctgaagtagttaatgaacttcatcaatgacannnnnnnnngtagtggttgggtt |
118 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| | ||||| | || |
|
|
| T |
9165802 |
gatgtaaatcaccaaaataagttgttgaaaatatcaatcaatttgattgaagtagttaatgaacttcaccaatgacatttttttttatggtggtcgaatt |
9165703 |
T |
|
| Q |
119 |
ttcaacttcaaaccttgcatataatatgcattgtttatacaaacagagctatttaaaacccaagtttaaattttagatggaacaattcttactttccaat |
218 |
Q |
| |
|
| ||||||| ||||||||||||| |||||||| || |||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9165702 |
t-caacttcgaaccttgcatatattatgcatttttcataccaacagagctatttaaaaccgaagtttaaattttagatggaacagttcttactttccaat |
9165604 |
T |
|
| Q |
219 |
ccaacttcatattat |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9165603 |
ccaacttcatattat |
9165589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 154
Target Start/End: Original strand, 11691828 - 11691856
Alignment:
| Q |
126 |
tcaaaccttgcatataatatgcattgttt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11691828 |
tcaaaccttgcatataatatgcattgttt |
11691856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 30956476 - 30956436
Alignment:
| Q |
129 |
aaccttgcatataatatgcattgtttatacaaacagagcta |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
30956476 |
aaccttgcatataatatgcattgttcataccaactgagcta |
30956436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 169
Target Start/End: Original strand, 44678031 - 44678071
Alignment:
| Q |
129 |
aaccttgcatataatatgcattgtttatacaaacagagcta |
169 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
44678031 |
aaccttgcatatattatgcattgtctatacaaactgagcta |
44678071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University