View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_315 (Length: 242)
Name: NF10261A_low_315
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_315 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 72 - 230
Target Start/End: Complemental strand, 25933423 - 25933262
Alignment:
| Q |
72 |
taacaagttggatgttaaattaatcatttttcaagaacaaacc---attattgtgttttgatgttaactttctgatttttagagaaagggcgttcaactt |
168 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25933423 |
taacaaattgtatgttaaattaatcatttttcaagaacaaaccgtaattattgtattttgatgttaactttctgattttcagagaaagggcgttcaactt |
25933324 |
T |
 |
| Q |
169 |
agtttaataaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933323 |
agtttaataaaaacgacaacaatcaaacattattccatctccttgactatgagacggatatt |
25933262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University