View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_320 (Length: 241)
Name: NF10261A_low_320
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_320 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 3790340 - 3790141
Alignment:
| Q |
19 |
aggaatagtagcaaatagtcatatttctcaacaagnnnnnnnntaaactcatcatctcaattaaaacttatctcgcttatgattattctaatttgttttc |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790340 |
aggaataggagcaaatagtcatatttctcaacaaggaaaaaa-taaactcatcatctcaattagaacttatctcgcttatgattattctaatttgttttc |
3790242 |
T |
|
| Q |
119 |
aattaatttgttgagtatgactactcatagacacatacgaggggaagggcgaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790241 |
aattaatttgttgagtatgactactcatagacacataagaggggaaggaagaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
3790142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University