View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_325 (Length: 240)
Name: NF10261A_low_325
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_325 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 6122591 - 6122795
Alignment:
| Q |
11 |
gatggacatcaaattatcaggaccctggatctggcaggcttagccttatgggaaaatagcattctaatttctagcttcagagaatatctctagttttatg |
110 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6122591 |
gatgggcaccaaattatcaggaccctggatctggcaggcttagccttatgggaaaatggcattctaatttctagcttcagagaatatctctagttttatg |
6122690 |
T |
|
| Q |
111 |
ttatagctcttgtttctgtaagggtatgctctatacatttccccgtgtgagaataccaggatacataaaatacatcaatcatcatttaatattaaataac |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6122691 |
ttatagctcttgtttctgtaagggtgtgctctatacatttccccgtgtgagaataccaggatacataaaatacatcaatcatcatttaatattaaataac |
6122790 |
T |
|
| Q |
211 |
ccaaa |
215 |
Q |
| |
|
||||| |
|
|
| T |
6122791 |
ccaaa |
6122795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University