View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_336 (Length: 238)
Name: NF10261A_low_336
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_336 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 238
Target Start/End: Original strand, 3271730 - 3271956
Alignment:
| Q |
12 |
atgaatagtttattactatcatttatggtatcatattcaatttgtaatggtattgaaatccaatctggacctctgtgaatgatcaatatatactcttcca |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3271730 |
atgaatagttcattactatcatttatggtatcctattcaatttgtaatggtattgaaatccaatctggagctctgtgaatgatcaatatatactcttcca |
3271829 |
T |
 |
| Q |
112 |
tcacatagagacaattgtttaagacattgaatttaagcagatgttctaacatttggacaaacggtgaatgcatggaacaaatgttaaaaccaaacacaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3271830 |
tcacatagagacaattgtttaagacattgaatttaagcagatgttctaacatttggacaaacggtgaatacatggaacaaatgttaaaaacaaacacaaa |
3271929 |
T |
 |
| Q |
212 |
acgctatgctgagctgtgagacaaaga |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3271930 |
acgctatgctgagctgtgagacaaaga |
3271956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University