View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_338 (Length: 237)
Name: NF10261A_low_338
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_338 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 36904218 - 36904015
Alignment:
| Q |
25 |
tttttagggttcttagtataatggtttgcttcaaaatttattagaacaatcgctttagtttgccttataaggccattatatttcagtatatgttcttgtt |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36904218 |
tttttggggttcttagtataatggtttgcttcaaaatttattagaacaatcgctttagtttgccttataaggccgttatatttcagtatatgttcttgtt |
36904119 |
T |
|
| Q |
125 |
tcctttttcttttactaaatgagtatacgatcttctattatttccattgccttgtttgtttttatatatgatgttttatcgtttgaaattttgtagatat |
224 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904118 |
ttctttttcttttactaaatgagtatacgatcttctattatttccattgccttgtttgtttttatatatgatgttttatcgtttgaaattttgtagatat |
36904019 |
T |
|
| Q |
225 |
tctt |
228 |
Q |
| |
|
|||| |
|
|
| T |
36904018 |
tctt |
36904015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 69 - 181
Target Start/End: Original strand, 37073736 - 37073847
Alignment:
| Q |
69 |
aacaatcgctttagtttgccttataaggccattatatttcagtatatgttcttgtttcctt-tttcttttactaaatgagtatacgatcttctattattt |
167 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||| |||| ||||||||| || ||| |||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
37073736 |
aacaatcgatttagcttgcctta--aggccattatatttgagtagatgttcttgctttcttctttcttttactatatgagcatacaatcttctattattt |
37073833 |
T |
|
| Q |
168 |
ccattgccttgttt |
181 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
37073834 |
ccattgctttgttt |
37073847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University