View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_339 (Length: 236)

Name: NF10261A_low_339
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_339
NF10261A_low_339
[»] chr2 (38 HSPs)
chr2 (14-152)||(19456511-19456649)
chr2 (14-149)||(21703254-21703389)
chr2 (14-152)||(27392982-27393120)
chr2 (14-152)||(34303393-34303531)
chr2 (14-152)||(3784667-3784805)
chr2 (14-152)||(16163612-16163750)
chr2 (14-152)||(34157024-34157162)
chr2 (14-149)||(27118704-27118839)
chr2 (42-152)||(31891446-31891556)
chr2 (42-164)||(28882215-28882337)
chr2 (42-164)||(12655543-12655665)
chr2 (42-164)||(21677300-21677422)
chr2 (42-164)||(23128684-23128806)
chr2 (14-164)||(27434534-27434684)
chr2 (14-154)||(40233522-40233662)
chr2 (21-164)||(11635283-11635426)
chr2 (21-164)||(22926125-22926268)
chr2 (42-164)||(20837919-20838041)
chr2 (21-164)||(11641472-11641615)
chr2 (21-164)||(34279450-34279593)
chr2 (42-164)||(34861681-34861803)
chr2 (42-164)||(37686027-37686149)
chr2 (42-164)||(37701292-37701414)
chr2 (21-164)||(34286355-34286498)
chr2 (21-164)||(34291415-34291558)
chr2 (42-164)||(37925494-37925616)
chr2 (42-164)||(31876282-31876404)
chr2 (21-154)||(37375172-37375305)
chr2 (42-89)||(16829456-16829503)
chr2 (42-89)||(16891978-16892025)
chr2 (42-89)||(39890150-39890197)
chr2 (64-154)||(12716742-12716832)
chr2 (64-154)||(13936684-13936774)
chr2 (64-154)||(27777233-27777323)
chr2 (64-154)||(27803718-27803808)
chr2 (64-154)||(27816991-27817081)
chr2 (42-164)||(32049799-32049921)
chr2 (64-154)||(39051962-39052052)
[»] chr1 (7 HSPs)
chr1 (21-152)||(20461097-20461228)
chr1 (14-152)||(16208132-16208270)
chr1 (14-152)||(20340436-20340574)
chr1 (14-152)||(28151878-28152016)
chr1 (21-164)||(41793416-41793559)
chr1 (42-164)||(28584985-28585107)
chr1 (42-164)||(10962674-10962796)
[»] chr7 (33 HSPs)
chr7 (14-152)||(16449985-16450123)
chr7 (14-149)||(16041344-16041479)
chr7 (14-152)||(26484712-26484850)
chr7 (14-152)||(2108992-2109130)
chr7 (14-152)||(2775377-2775515)
chr7 (14-152)||(31088451-31088589)
chr7 (14-152)||(39211010-39211148)
chr7 (14-152)||(45733478-45733616)
chr7 (22-164)||(18540805-18540947)
chr7 (42-164)||(11424791-11424913)
chr7 (21-164)||(5127998-5128141)
chr7 (42-164)||(10916883-10917005)
chr7 (42-164)||(16503395-16503517)
chr7 (42-164)||(16518431-16518553)
chr7 (21-164)||(5147334-5147477)
chr7 (42-154)||(2154589-2154701)
chr7 (21-164)||(16736454-16736597)
chr7 (21-164)||(16751508-16751651)
chr7 (21-164)||(17523538-17523681)
chr7 (21-164)||(17529534-17529677)
chr7 (42-164)||(4145138-4145260)
chr7 (42-164)||(9618657-9618779)
chr7 (42-164)||(26275109-26275231)
chr7 (42-164)||(26319884-26320006)
chr7 (42-164)||(45387349-45387471)
chr7 (42-154)||(3445322-3445434)
chr7 (42-164)||(26669929-26670051)
chr7 (21-154)||(26435273-26435406)
chr7 (42-154)||(11441588-11441700)
chr7 (42-154)||(26537885-26537997)
chr7 (42-154)||(31564405-31564517)
chr7 (42-154)||(31124936-31125048)
chr7 (22-154)||(5159535-5159667)
[»] scaffold0558 (1 HSPs)
scaffold0558 (14-152)||(129-267)
[»] chr4 (24 HSPs)
chr4 (14-152)||(15227902-15228040)
chr4 (14-152)||(15285029-15285167)
chr4 (14-152)||(1900289-1900427)
chr4 (14-152)||(15391439-15391577)
chr4 (14-152)||(24460706-24460844)
chr4 (14-152)||(14235626-14235764)
chr4 (21-164)||(17014020-17014163)
chr4 (21-164)||(14763412-14763555)
chr4 (42-164)||(24592443-24592565)
chr4 (21-164)||(5005893-5006036)
chr4 (42-164)||(14098561-14098683)
chr4 (42-164)||(14665038-14665160)
chr4 (42-164)||(27163446-27163568)
chr4 (42-154)||(18800742-18800854)
chr4 (42-154)||(30753784-30753896)
chr4 (21-164)||(6569873-6570016)
chr4 (42-164)||(31126647-31126769)
chr4 (21-154)||(33673906-33674039)
chr4 (42-164)||(40105767-40105889)
chr4 (21-154)||(36344623-36344756)
chr4 (64-154)||(39850668-39850758)
chr4 (21-154)||(54833417-54833550)
chr4 (22-154)||(24112692-24112824)
chr4 (22-154)||(34189069-34189201)
[»] scaffold0124 (2 HSPs)
scaffold0124 (14-152)||(20405-20543)
scaffold0124 (42-89)||(30532-30579)
[»] chr3 (56 HSPs)
chr3 (14-152)||(16626648-16626786)
chr3 (14-152)||(18530366-18530504)
chr3 (14-152)||(4625922-4626060)
chr3 (14-152)||(31034259-31034397)
chr3 (14-152)||(32292730-32292868)
chr3 (14-152)||(17993926-17994064)
chr3 (14-152)||(5652365-5652503)
chr3 (42-164)||(15892876-15892998)
chr3 (42-164)||(8295938-8296060)
chr3 (42-164)||(8301437-8301559)
chr3 (42-164)||(18330635-18330757)
chr3 (21-154)||(22387727-22387860)
chr3 (42-154)||(6542632-6542744)
chr3 (21-164)||(4721597-4721740)
chr3 (21-164)||(5609471-5609614)
chr3 (21-164)||(28339268-28339411)
chr3 (21-164)||(31964622-31964765)
chr3 (21-164)||(50134220-50134363)
chr3 (42-164)||(4796823-4796945)
chr3 (42-164)||(15741264-15741386)
chr3 (42-164)||(17985126-17985248)
chr3 (42-164)||(18051228-18051350)
chr3 (42-154)||(36997247-36997359)
chr3 (21-164)||(4416885-4417028)
chr3 (21-164)||(6192282-6192425)
chr3 (21-164)||(18277201-18277344)
chr3 (21-164)||(18292502-18292645)
chr3 (21-164)||(18307803-18307946)
chr3 (21-164)||(29148904-29149047)
chr3 (42-164)||(7996528-7996650)
chr3 (42-164)||(10643036-10643158)
chr3 (42-164)||(35880732-35880854)
chr3 (42-164)||(47023419-47023541)
chr3 (42-154)||(5713203-5713315)
chr3 (42-154)||(5724113-5724225)
chr3 (42-154)||(5757252-5757364)
chr3 (42-154)||(5768143-5768255)
chr3 (21-164)||(10396099-10396242)
chr3 (21-164)||(28116103-28116246)
chr3 (21-154)||(11110498-11110631)
chr3 (21-154)||(21674669-21674802)
chr3 (42-101)||(5467014-5467073)
chr3 (21-164)||(7073178-7073321)
chr3 (42-101)||(51782052-51782111)
chr3 (21-154)||(4346836-4346969)
chr3 (21-154)||(48465903-48466036)
chr3 (42-154)||(5013688-5013800)
chr3 (42-154)||(18242715-18242827)
chr3 (42-89)||(5596527-5596574)
chr3 (50-101)||(51797141-51797192)
chr3 (64-154)||(20577039-20577129)
chr3 (64-154)||(29665162-29665252)
chr3 (21-154)||(8211714-8211847)
chr3 (21-154)||(22871005-22871138)
chr3 (21-154)||(22886064-22886197)
chr3 (21-154)||(28021251-28021384)
[»] chr5 (48 HSPs)
chr5 (14-149)||(22888499-22888634)
chr5 (14-148)||(25199059-25199193)
chr5 (14-152)||(23892232-23892370)
chr5 (14-152)||(13184646-13184784)
chr5 (14-152)||(33877273-33877411)
chr5 (14-152)||(11325820-11325958)
chr5 (14-152)||(13440492-13440630)
chr5 (14-152)||(29889080-29889218)
chr5 (21-164)||(23752455-23752598)
chr5 (42-164)||(11549368-11549490)
chr5 (42-164)||(23718014-23718136)
chr5 (42-164)||(30934647-30934769)
chr5 (42-164)||(2511065-2511187)
chr5 (42-164)||(8665501-8665623)
chr5 (42-164)||(15758883-15759005)
chr5 (42-164)||(24688183-24688305)
chr5 (42-164)||(24970032-24970154)
chr5 (21-164)||(6874319-6874462)
chr5 (21-164)||(33777501-33777644)
chr5 (42-164)||(26480406-26480528)
chr5 (21-154)||(37671488-37671621)
chr5 (42-154)||(31431464-31431576)
chr5 (21-164)||(9548548-9548691)
chr5 (21-164)||(22999119-22999262)
chr5 (42-164)||(5637924-5638046)
chr5 (42-164)||(9317465-9317587)
chr5 (42-164)||(12132169-12132291)
chr5 (42-164)||(30152032-30152154)
chr5 (42-164)||(30168483-30168605)
chr5 (21-154)||(18500735-18500868)
chr5 (21-154)||(28649259-28649392)
chr5 (42-154)||(31826433-31826545)
chr5 (42-154)||(34616542-34616654)
chr5 (21-164)||(15658765-15658908)
chr5 (21-164)||(41674723-41674866)
chr5 (21-154)||(37770992-37771125)
chr5 (42-154)||(28959812-28959924)
chr5 (42-154)||(37358669-37358781)
chr5 (42-164)||(18375438-18375560)
chr5 (21-154)||(32599477-32599610)
chr5 (21-154)||(43078276-43078409)
chr5 (42-154)||(3789565-3789677)
chr5 (42-154)||(37755004-37755116)
chr5 (42-89)||(33516445-33516492)
chr5 (64-154)||(24681464-24681554)
chr5 (64-154)||(24723991-24724081)
chr5 (64-154)||(40473597-40473687)
chr5 (22-154)||(33292549-33292681)
[»] scaffold0260 (1 HSPs)
scaffold0260 (14-152)||(2759-2897)
[»] chr6 (45 HSPs)
chr6 (14-152)||(22456978-22457116)
chr6 (14-152)||(22477317-22477455)
chr6 (14-152)||(27290414-27290552)
chr6 (14-152)||(8892354-8892492)
chr6 (14-152)||(8903589-8903727)
chr6 (14-152)||(13522117-13522255)
chr6 (14-152)||(14143329-14143467)
chr6 (14-152)||(26787958-26788096)
chr6 (14-152)||(27196331-27196469)
chr6 (14-152)||(27252771-27252909)
chr6 (14-152)||(33374300-33374438)
chr6 (14-152)||(28162671-28162809)
chr6 (16-152)||(20160715-20160851)
chr6 (16-152)||(22171980-22172116)
chr6 (14-164)||(22934924-22935074)
chr6 (14-164)||(23857369-23857519)
chr6 (14-154)||(27272624-27272764)
chr6 (21-164)||(26918382-26918525)
chr6 (42-164)||(13299023-13299145)
chr6 (42-164)||(24304690-24304812)
chr6 (42-164)||(26989003-26989125)
chr6 (21-164)||(16749856-16749999)
chr6 (42-164)||(15424389-15424511)
chr6 (42-164)||(24863719-24863841)
chr6 (42-164)||(27000075-27000197)
chr6 (42-154)||(4525298-4525410)
chr6 (21-154)||(29549487-29549620)
chr6 (42-154)||(3696093-3696205)
chr6 (42-154)||(4545847-4545959)
chr6 (42-154)||(4724206-4724318)
chr6 (42-154)||(4773018-4773130)
chr6 (42-154)||(28207466-28207578)
chr6 (21-154)||(16674151-16674284)
chr6 (21-154)||(34463397-34463530)
chr6 (42-154)||(4757776-4757888)
chr6 (42-154)||(29573025-29573137)
chr6 (21-154)||(27007739-27007872)
chr6 (21-154)||(27044399-27044532)
chr6 (42-154)||(27485141-27485253)
chr6 (42-89)||(26777687-26777734)
chr6 (42-89)||(29501492-29501539)
chr6 (42-89)||(30558088-30558135)
chr6 (42-83)||(26116482-26116523)
chr6 (42-154)||(27360064-27360176)
chr6 (42-154)||(27450407-27450519)
[»] chr8 (21 HSPs)
chr8 (14-152)||(44563118-44563256)
chr8 (14-152)||(9354639-9354777)
chr8 (14-152)||(19659099-19659237)
chr8 (14-152)||(22080938-22081076)
chr8 (14-152)||(33244682-33244820)
chr8 (14-149)||(16283469-16283604)
chr8 (42-164)||(16277559-16277681)
chr8 (21-164)||(31354529-31354672)
chr8 (42-164)||(2137347-2137469)
chr8 (42-164)||(19688103-19688225)
chr8 (42-164)||(27608993-27609115)
chr8 (42-164)||(14557629-14557751)
chr8 (42-164)||(19208448-19208570)
chr8 (42-164)||(31489838-31489960)
chr8 (21-164)||(19674446-19674589)
chr8 (42-164)||(28362043-28362165)
chr8 (42-154)||(3329595-3329707)
chr8 (21-154)||(18710601-18710734)
chr8 (42-154)||(12092812-12092924)
chr8 (41-101)||(29829390-29829450)
chr8 (21-154)||(19286477-19286610)
[»] scaffold0109 (1 HSPs)
scaffold0109 (14-152)||(21578-21716)
[»] scaffold0415 (2 HSPs)
scaffold0415 (14-99)||(2018-2103)
scaffold0415 (21-101)||(6080-6160)
[»] scaffold0143 (1 HSPs)
scaffold0143 (42-164)||(27297-27419)
[»] scaffold0089 (3 HSPs)
scaffold0089 (42-164)||(29768-29890)
scaffold0089 (42-164)||(40198-40320)
scaffold0089 (42-164)||(47114-47236)
[»] scaffold0159 (2 HSPs)
scaffold0159 (42-164)||(9195-9317)
scaffold0159 (42-164)||(20020-20142)
[»] scaffold0350 (1 HSPs)
scaffold0350 (42-164)||(7368-7490)
[»] scaffold0038 (1 HSPs)
scaffold0038 (42-154)||(7964-8076)
[»] scaffold0144 (1 HSPs)
scaffold0144 (49-164)||(26338-26453)
[»] scaffold0029 (1 HSPs)
scaffold0029 (42-164)||(258-381)
[»] scaffold0237 (1 HSPs)
scaffold0237 (42-164)||(15059-15181)
[»] scaffold0336 (1 HSPs)
scaffold0336 (21-154)||(9581-9714)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 38)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 19456511 - 19456649
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  19456511 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctatgagaagtagagt 19456610  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||||||||||||||||||||||||    
T  19456611 cgggagtaactcggcatatagcattggtatcggaggaaa 19456649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 21703254 - 21703389
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  21703254 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgtcctgtctggttgtgcagtgccctctgagaagtagagt 21703353  T
Q  114 cgggagtaactcggcatatagcattggtatcggagg 149  Q
    |||||||||||| ||||| | |||||||||||||||    
T  21703354 cgggagtaactcagcatacaacattggtatcggagg 21703389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 27393120 - 27392982
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| | |||    
T  27393120 gatggaaatcgcacttgaggtcagaatggaacctgggaggcaacgggttaggtggaggcttgccctgcctggttgtgcagtgccctttgagaagcaaagt 27393021  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| | ||||||||| | ||||||||||||||||||    
T  27393020 cgggagcagctcggcatacatcattggtatcggaggaaa 27392982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 34303393 - 34303531
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34303393 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34303492  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  34303493 cgggagtaattcagcatataacattggtatcagaggaaa 34303531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 3784805 - 3784667
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  3784805 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 3784706  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  3784705 cgggagtaattcagcatataacattggtatcagaggaaa 3784667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 16163750 - 16163612
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  16163750 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 16163651  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  16163650 cgggagtaattcagcatataacattggtatcagaggaaa 16163612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 34157162 - 34157024
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34157162 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34157063  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  34157062 cgggagtaattcagcatataacattggtatcagaggaaa 34157024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 27118839 - 27118704
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  27118839 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 27118740  T
Q  114 cgggagtaactcggcatatagcattggtatcggagg 149  Q
    ||||||||| || ||||| | ||| |||||||||||    
T  27118739 cgggagtaattcagcatacaacatcggtatcggagg 27118704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 42 - 152
Target Start/End: Original strand, 31891446 - 31891556
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |||||||    
T  31891446 gaaccttggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagtaattcagcatataacattggt 31891545  T
Q  142 atcggaggaaa 152  Q
    ||| |||||||    
T  31891546 atcagaggaaa 31891556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 28882337 - 28882215
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28882337 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 28882238  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  28882237 atcggagggaaagtaggtctagc 28882215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 12655665 - 12655543
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12655665 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 12655566  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  12655565 atcggagggaaagtaggtctagc 12655543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 21677300 - 21677422
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  21677300 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 21677399  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  21677400 atcggagggaaagtaggcctagc 21677422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 23128684 - 23128806
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  23128684 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 23128783  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  23128784 atcggagggaaagtaggtctagc 23128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 164
Target Start/End: Original strand, 27434534 - 27434684
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||   |||| ||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||     
T  27434534 gatggaaatcacatttgaggtcggacctgaacttgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagc 27434633  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||| || ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  27434634 cggaagcaactcagcatacaacatcggtatcggagggaaagtaggtctagc 27434684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 154
Target Start/End: Complemental strand, 40233662 - 40233522
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| |||    
T  40233662 gatggaaatcacatttgaggtcagaccggaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagt 40233563  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
     || || | ||| ||||| | ||||||||| ||||||||||    
T  40233562 tggaagaagctcagcatacaacattggtataggaggaaaag 40233522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 11635283 - 11635426
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11635283 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11635382  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  11635383 aactcagcatataacatcggtatcggagggaaagtaggtctagc 11635426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 22926125 - 22926268
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  22926125 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 22926224  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  22926225 aactcagcatataacatcggtatcggagggaaagtaggcctagc 22926268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 20838041 - 20837919
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20838041 gaacctgggaggcaacagatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 20837942  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  20837941 atcggagggaaagtaggtctagc 20837919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 11641472 - 11641615
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11641472 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11641571  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| |||  |||||||||| |||| ||| |||||    
T  11641572 aactcagcatataacatctgtatcggagggaaagtaggtctagc 11641615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 34279593 - 34279450
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34279593 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34279494  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  34279493 aactcagcatataacatcggtatcggagggaaagtaggtctagc 34279450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 34861803 - 34861681
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  34861803 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 34861704  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  34861703 atcggagggaaagtaggcctagc 34861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 37686027 - 37686149
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37686027 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37686126  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  37686127 atcggagggaaagtaggcctagc 37686149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 37701292 - 37701414
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37701292 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37701391  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  37701392 atcggagggaaagtaggcctagc 37701414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 34286498 - 34286355
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34286498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34286399  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||| ||||| |||| ||| |||||    
T  34286398 aactcagcatataacatcggtattggagggaaagtaggtctagc 34286355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 34291558 - 34291415
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34291558 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34291459  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||| ||||| |||| ||| |||||    
T  34291458 aactcagcatataacatcggtattggagggaaagtaggtctagc 34291415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 37925616 - 37925494
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||| |  ||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  37925616 gaaccttggaggcaacgggtcgggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacattggt 37925517  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  37925516 atcggagggaaagtaggcctagc 37925494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 31876404 - 31876282
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  31876404 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 31876305  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  31876304 ataggaggaaaagtaggcctagc 31876282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 37375305 - 37375172
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  37375305 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 37375206  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||| ||||| ||||||||||    
T  37375205 agctctgcatacaacataggtataggaggaaaag 37375172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 16829456 - 16829503
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  16829456 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 16829503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 16892025 - 16891978
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  16892025 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 16891978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 39890197 - 39890150
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  39890197 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 39890150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 12716742 - 12716832
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  12716742 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 12716832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 13936684 - 13936774
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||||||||| ||||    
T  13936684 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtatcggagggaaag 13936774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 27777323 - 27777233
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  27777323 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 27777233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 27803808 - 27803718
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  27803808 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 27803718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 27817081 - 27816991
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  27817081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 27816991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 32049921 - 32049799
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||| |  ||||| || || |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  32049921 gaaccttggaggcaacgggtccggtgggggtttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 32049822  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  32049821 atcggagggaaagtaggcctagc 32049799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 39051962 - 39052052
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  39051962 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 39052052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 152
Target Start/End: Complemental strand, 20461228 - 20461097
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20461228 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20461129  T
Q  121 aactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||| |||||||||||||    
T  20461128 aactcggcatatagcattagtatcggaggaaa 20461097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 16208132 - 16208270
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||    
T  16208132 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggttttccctgtctggttgtgcagtgccctctgagaagtagagt 16208231  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||| ||| | ||||||||||||||||||    
T  16208232 cgggagtaactcggtatacaacattggtatcggaggaaa 16208270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 20340436 - 20340574
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  20340436 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 20340535  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
     ||||||| ||||||||||||||||||||||||||||||    
T  20340536 tgggagtagctcggcatatagcattggtatcggaggaaa 20340574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 28152016 - 28151878
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||| ||||||||| ||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  28152016 gatggaaatcacatttgaggtcagaccggagcctgggaggtaacagatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 28151917  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  28151916 cgggagcaactcagcatatagcattggtatcagaggaaa 28151878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 41793416 - 41793559
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41793416 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 41793515  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  41793516 aactcagcatataacatcggtatcggagggaaagtaggcctagc 41793559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 28585107 - 28584985
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28585107 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28585008  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  28585007 atcggagggaaagtaggcctagc 28584985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 10962796 - 10962674
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | || | ||| || || ||||| ||||||| ||| |||    
T  10962796 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagcaaagttggaagcaactcagcatataacatcggt 10962697  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  10962696 atcggagggaaagtaggcctagc 10962674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 33)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 16449985 - 16450123
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16449985 gatggaaatcacacttgaggtcagaacgaaacctgggaggcaaaggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16450084  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||||||||||||||||||||||||    
T  16450085 cgggagtaactcggcatatagcattggtatcggaggaaa 16450123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 16041479 - 16041344
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041479 gatggaaatcacactttaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16041380  T
Q  114 cgggagtaactcggcatatagcattggtatcggagg 149  Q
    |||||||||||||||||| | |||||||||||||||    
T  16041379 cgggagtaactcggcatacaacattggtatcggagg 16041344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 26484850 - 26484712
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  26484850 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 26484751  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  26484750 cgggagcaactcagcatatagcattggtatcagaggaaa 26484712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 2108992 - 2109130
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2108992 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2109091  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| ||||||| |||||||||| |||||||    
T  2109092 cgggagcaactcagcatatatcattggtatcagaggaaa 2109130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 2775515 - 2775377
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2775515 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2775416  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||  |||| |||||||||||||||||| |||||||    
T  2775415 cgggagctactcagcatatagcattggtatcagaggaaa 2775377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 31088451 - 31088589
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  31088451 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 31088550  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  31088551 cgggagtaattcagcatataacattggtatcagaggaaa 31088589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 39211010 - 39211148
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||    
T  39211010 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaagcttcccctgtctgattgtgcagtgccctctgagaagtagagt 39211109  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  39211110 cgggagcaactcagcatatagcattggtatcagaggaaa 39211148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 45733616 - 45733478
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  45733616 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 45733517  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
       |||||| || ||||||| |||||||||| |||||||    
T  45733516 taagagtaattcagcatataacattggtatcagaggaaa 45733478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 22 - 164
Target Start/End: Complemental strand, 18540947 - 18540805
Alignment:
Q  22 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 121  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |    
T  18540947 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagca 18540848  T
Q  122 actcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    |||| |||||||||||||||||| ||||||||| ||| |||||    
T  18540847 actcagcatatagcattggtatcagaggaaaagtaggtctagc 18540805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 11424791 - 11424913
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  11424791 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtgcaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 11424890  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  11424891 atcggagggaaagtaggtctagc 11424913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 5128141 - 5127998
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| |||||||||||||||||||| ||||| |||||||||||||| || ||||||||  | |||| ||| || ||     
T  5128141 atcacatttgagatcagacctgaaccttggaggcaacggattaggtgggggcttaccctgtctggttgtacaatgccctctatggagtaaagttggaagc 5128042  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| |||||||||||||||| ||| |||||    
T  5128041 aactcagcatacaacatcggtatcggaggaaaagtaggtctagc 5127998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 10916883 - 10917005
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  10916883 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 10916982  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  10916983 atcggagggaaagtaggtctagc 10917005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 16503395 - 16503517
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16503395 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16503494  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  16503495 atcggagggaaagtaggtctagc 16503517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 16518431 - 16518553
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16518431 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16518530  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  16518531 atcggagggaaagtaggtctagc 16518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 5147334 - 5147477
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5147334 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 5147433  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| |||||||||||||||| ||| |||||    
T  5147434 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 5147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 2154701 - 2154589
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  2154701 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 2154602  T
Q  142 atcggaggaaaag 154  Q
    |||||||| ||||    
T  2154601 atcggagggaaag 2154589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 16736454 - 16736597
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16736454 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16736553  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  16736554 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16736597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 16751508 - 16751651
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16751508 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16751607  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  16751608 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16751651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 17523681 - 17523538
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17523681 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17523582  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  17523581 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17523538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 17529534 - 17529677
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17529534 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17529633  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  17529634 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17529677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 4145138 - 4145260
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  4145138 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 4145237  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  4145238 atcggagggaaagtaggcctagc 4145260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 9618779 - 9618657
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9618779 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9618680  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  9618679 atcggagggaaagtaggcctagc 9618657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 26275109 - 26275231
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26275109 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26275208  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  26275209 atcggagggaaagtaggcctagc 26275231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 26319884 - 26320006
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26319884 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26319983  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  26319984 atcggagggaaagtaggcctagc 26320006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 45387471 - 45387349
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  45387471 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 45387372  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  45387371 atcggagggaaagtaggcctagc 45387349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 3445434 - 3445322
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  3445434 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 3445335  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  3445334 ataggaggaaaag 3445322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 26669929 - 26670051
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| || |||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26669929 gaaccttgggggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26670028  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  26670029 atcggagggaaagtaggcctagc 26670051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 26435406 - 26435273
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  26435406 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 26435307  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  26435306 agttctgcatacaacattggtataggaggaaaag 26435273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 11441700 - 11441588
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  11441700 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcgtacaacattggt 11441601  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  11441600 ataggaggaaaag 11441588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 26537885 - 26537997
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || |  || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26537885 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgcacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26537984  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  26537985 ataggaggaaaag 26537997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 31564405 - 31564517
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  31564405 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 31564504  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  31564505 ataggaggaaaag 31564517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 31125048 - 31124936
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  31125048 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 31124949  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  31124948 ataggaggaaaag 31124936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 154
Target Start/End: Complemental strand, 5159667 - 5159535
Alignment:
Q  22 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 121  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  5159667 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 5159568  T
Q  122 actcggcatatagcattggtatcggaggaaaag 154  Q
     ||| ||||| | ||||||||| ||||||||||    
T  5159567 gctctgcatacaacattggtataggaggaaaag 5159535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 129 - 267
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||    
T  129 gatggaaatcacacttgaggtcagaacggaacctggaaggcaacggatcaggtggaggcttgccatgtctggttgagcagtgccctctgagaagtagagt 228  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||||||||||||||||||||||||    
T  229 cgggagtaactcggcatatagcattggtatcggaggaaa 267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 24)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 15228040 - 15227902
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  15228040 gatggaaatcacacttgaggtcagaacggaacctgggaggcaatggatcaggtggaggcttaccctgtctggttgtacagtgccctctgagaagtagagt 15227941  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||||||||||||||||||||||||    
T  15227940 cgggagtaactcggcatatagcattggtatcggaggaaa 15227902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 15285029 - 15285167
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15285029 gatggaaatcacacttgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 15285128  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||  ||||||||||||||||||||||||    
T  15285129 cgggagtaactcgaaatatagcattggtatcggaggaaa 15285167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 1900427 - 1900289
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| | |||||| || ||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||    
T  1900427 gatggaaatcacacttgaggtcagaacgaaacctgagaagcaacggatcaggtggaggcttaccatgtctggttgtgcagtgccctctgagaagtagagt 1900328  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  1900327 cgggagtaactcggcatacagcattggtatcggaggaaa 1900289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 15391439 - 15391577
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  15391439 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggcttcccctgcctggttgtgcagtgccctttgagaagcaaagt 15391538  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| |||||||| || ||||||||||||||||||||    
T  15391539 cgggagcaactcggcgtacagcattggtatcggaggaaa 15391577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 24460706 - 24460844
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  24460706 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 24460805  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  24460806 cgggagtaattcagcatataacattggtatcagaggaaa 24460844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 14235626 - 14235764
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| ||||||||  ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| | ||||| |||||    
T  14235626 gatggaaatcacatttgaggtcgaaatggaacctgggaggcaaagggttaggtggaggcttgccctgtctggttgtacagtgccctttaagaagcagagt 14235725  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| | ||||||||| | |||||||||| |||||||    
T  14235726 cgggagcagctcggcatacaacattggtatcagaggaaa 14235764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 17014163 - 17014020
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  17014163 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctttggagtaaagtcggaagc 17014064  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  17014063 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 17014020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 14763412 - 14763555
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  14763412 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 14763511  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  14763512 aactcagcatataacatcggtatcggagggaaagtaggtctagc 14763555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 24592443 - 24592565
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24592443 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24592542  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  24592543 atcggagggaaagtaggtctagc 24592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 5006036 - 5005893
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||| ||||| ||||| || ||||||||  | |||| ||| || ||     
T  5006036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccttgtctagttgtacaatgccctctctggagtaaagttggaagc 5005937  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  5005936 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5005893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 14098683 - 14098561
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  14098683 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 14098584  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  14098583 ataggaggaaaagtaggtctagc 14098561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 14665160 - 14665038
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  14665160 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagcaactcagcatacaacatcggt 14665061  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  14665060 atcggagggaaagtaggtctagc 14665038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 27163446 - 27163568
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  27163446 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 27163545  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  27163546 atcggagggaaagtaggcctagc 27163568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 18800742 - 18800854
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  18800742 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 18800841  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  18800842 ataggaggaaaag 18800854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 30753896 - 30753784
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  30753896 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 30753797  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  30753796 ataggaggaaaag 30753784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 6570016 - 6569873
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  6570016 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 6569917  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    |  || ||||| | ||||||||||||||| |||| ||| |||||    
T  6569916 agttctgcatacaacattggtatcggagggaaagtaggtctagc 6569873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 31126647 - 31126769
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||| | |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  31126647 gaaccttggaggcaacgggtcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 31126746  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  31126747 ataggaggaaaagtaggcctagc 31126769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 33673906 - 33674039
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||| |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||     
T  33673906 atcacatttgagatcagacctgaaccttggaggcaacgggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagc 33674005  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  33674006 aactcagcatacaacattggtataggaggaaaag 33674039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 40105767 - 40105889
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || |  || ||||||| ||| |||    
T  40105767 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagaagttcagcatataacatcggt 40105866  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  40105867 atcggagggaaagtaggcctagc 40105889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 36344623 - 36344756
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  36344623 atcacatttgagatcagacctgaacctcggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 36344722  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||| ||||| ||||||||||    
T  36344723 agctctgcatacaacataggtataggaggaaaag 36344756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 39850758 - 39850668
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  39850758 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 39850668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 54833550 - 54833417
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  54833550 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 54833451  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||| ||||| ||||||||||    
T  54833450 agctctgcatacaacataggtataggaggaaaag 54833417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 154
Target Start/End: Complemental strand, 24112824 - 24112692
Alignment:
Q  22 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 121  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  24112824 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 24112725  T
Q  122 actcggcatatagcattggtatcggaggaaaag 154  Q
     ||| ||||| | ||||||||| ||||||||||    
T  24112724 gctctgcatacaacattggtataggaggaaaag 24112692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 154
Target Start/End: Original strand, 34189069 - 34189201
Alignment:
Q  22 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 121  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  34189069 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 34189168  T
Q  122 actcggcatatagcattggtatcggaggaaaag 154  Q
     ||| ||||| | ||||||||| ||||||||||    
T  34189169 gctctgcatacaacattggtataggaggaaaag 34189201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 20543 - 20405
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20543 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 20444  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||| ||||| | |||||||||||| |||||    
T  20443 cgggagtaactcagcatacaacattggtatcgggggaaa 20405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 30579 - 30532
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  30579 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 56)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 16626648 - 16626786
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16626648 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctaagaagtagagt 16626747  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
     |||||||||||| |||||| ||||||||||||||||||    
T  16626748 agggagtaactcgacatatatcattggtatcggaggaaa 16626786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 18530504 - 18530366
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18530504 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 18530405  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    | |||||||||| ||||| | ||||||||||||||||||    
T  18530404 caggagtaactcagcatacaacattggtatcggaggaaa 18530366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 4626060 - 4625922
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4626060 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 4625961  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  4625960 cgggagtaattcagcatataacattggtatcagaggaaa 4625922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 31034259 - 31034397
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  31034259 gatggaaatcacatttgaggtcagaccggaacctaggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 31034358  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  31034359 cgggagcaactcagcatatagcattggtatcagaggaaa 31034397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 32292868 - 32292730
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||||||||||||||    
T  32292868 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggagacttcccctgtctgattgtgcagtgccctctgagaagtagagt 32292769  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  32292768 cgggagcaactcagcatatagcattggtatcagaggaaa 32292730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 17993926 - 17994064
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  17993926 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 17994025  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  17994026 cgggagtaattcagcatataacattggtatcagaggaaa 17994064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 5652503 - 5652365
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
T  5652503 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtgaaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 5652404  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  5652403 cgggagtaattcagcatataacattggtatcagaggaaa 5652365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 15892876 - 15892998
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    ||||||||||||||| |||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | |||||||    
T  15892876 gaacctgggaggcaaaggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacattggt 15892975  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  15892976 atcggagggaaagtaggtctagc 15892998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 8296060 - 8295938
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||| ||| |||| | |||||||||||||||||||| || ||||||||| | |||| |||||| || ||||| ||||| | ||| |||    
T  8296060 gaacctgggaggcaacagatcaggtaggggcttgccctgtctggttgtacaatgccctctgtggagtaaagtcggaagcaactcagcatacaacatcggt 8295961  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  8295960 atcggagggaaagtaggtctagc 8295938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 8301437 - 8301559
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  8301437 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 8301536  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  8301537 atcggagggaaagtaggtctagc 8301559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 18330757 - 18330635
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | ||||  ||||| || ||||| ||||||| ||| |||    
T  18330757 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaggtcggaagcaactcagcatataacatcggt 18330658  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  18330657 atcggagggaaagtaggtctagc 18330635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 22387727 - 22387860
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  22387727 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 22387826  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  22387827 aactctgcatacaacattggtataggaggaaaag 22387860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 6542632 - 6542744
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  6542632 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 6542731  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  6542732 ataggaggaaaag 6542744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 4721740 - 4721597
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| |||||||| ||   |||||| ||||||| ||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  4721740 atcacatttgaggtcggacctgaaccttggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 4721641  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  4721640 aactcagcatataacatcggtatcggagggaaagtaggtctagc 4721597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 5609471 - 5609614
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5609471 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 5609570  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  5609571 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5609614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 28339411 - 28339268
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28339411 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28339312  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  28339311 aactcagcatataacatcggtatcggagggaaagtaggcctagc 28339268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 31964622 - 31964765
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31964622 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31964721  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  31964722 aactcagcatataacatcggtatcggagggaaagtaggcctagc 31964765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 50134220 - 50134363
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  50134220 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 50134319  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  50134320 aactcagcatataacatcggtatcggagggaaagtaggcctagc 50134363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 4796823 - 4796945
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  4796823 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 4796922  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  4796923 atcggagggaaagtaggtctagc 4796945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 15741264 - 15741386
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| |||||||||| || |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15741264 gaaccttggaggcaacgaatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 15741363  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  15741364 atcggagggaaagtaggtctagc 15741386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 17985126 - 17985248
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  17985126 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 17985225  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  17985226 ataggaggaaaagtaggtctagc 17985248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 18051350 - 18051228
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||| ||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  18051350 gaacctgggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 18051251  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  18051250 atcggagggaaagtaggtctagc 18051228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 36997247 - 36997359
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  36997247 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 36997346  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  36997347 ataggaggaaaag 36997359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 4417028 - 4416885
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  4417028 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 4416929  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  4416928 aactcagcatataacatcggtatcggagggaaagtaggcctagc 4416885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 6192425 - 6192282
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| |||||||| ||   |||||| ||||||| | ||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  6192425 atcacatttgaggtcggacctgaaccttggaggcagcagatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 6192326  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  6192325 aactcagcatataacatcggtatcggagggaaagtaggtctagc 6192282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 18277201 - 18277344
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18277201 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18277300  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  18277301 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 18292502 - 18292645
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18292502 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18292601  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  18292602 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18292645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 18307803 - 18307946
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18307803 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18307902  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  18307903 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 29148904 - 29149047
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  29148904 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 29149003  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  29149004 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 29149047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 7996650 - 7996528
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7996650 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7996551  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  7996550 atcggagggaaagtaggcctagc 7996528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 10643158 - 10643036
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  10643158 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 10643059  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  10643058 atcggagggaaagtaggcctagc 10643036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 35880854 - 35880732
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||| ||||| |||||| |||||||||||| ||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  35880854 gaaccttggaggcagcggatcaggtgggggcttgccctgtttggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 35880755  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  35880754 atcggagggaaagtaggtctagc 35880732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 47023541 - 47023419
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  47023541 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 47023442  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  47023441 atcggagggaaagtaggcctagc 47023419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 5713315 - 5713203
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5713315 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5713216  T
Q  142 atcggaggaaaag 154  Q
    |||||||| ||||    
T  5713215 atcggagggaaag 5713203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 5724225 - 5724113
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5724225 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5724126  T
Q  142 atcggaggaaaag 154  Q
    |||||||| ||||    
T  5724125 atcggagggaaag 5724113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 5757252 - 5757364
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5757252 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5757351  T
Q  142 atcggaggaaaag 154  Q
    |||||||| ||||    
T  5757352 atcggagggaaag 5757364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 5768143 - 5768255
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5768143 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5768242  T
Q  142 atcggaggaaaag 154  Q
    |||||||| ||||    
T  5768243 atcggagggaaag 5768255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 10396242 - 10396099
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||||||||| |||||  | |||| ||| || ||     
T  10396242 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtgcagtgtcctctctggagtaaagttggaaga 10396143  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    | ||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  10396142 agctctgcatacaacataggtatcggagggaaagtaggtctagc 10396099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 28116103 - 28116246
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| | |||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28116103 atcacatttgagatcagacctgaaccttggaggcaacggatcaagtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28116202  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    || || ||||||| ||| ||||||||||| |||| ||| |||||    
T  28116203 aattcagcatataacatcggtatcggagggaaagtaggtctagc 28116246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 11110498 - 11110631
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||||||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  11110498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 11110597  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  11110598 agttctgcatacaacattggtataggaggaaaag 11110631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 21674802 - 21674669
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  21674802 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtagagttggaaga 21674703  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  21674702 agttctgcatacaacattggtataggaggaaaag 21674669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 101
Target Start/End: Complemental strand, 5467073 - 5467014
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 101  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  5467073 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 5467014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 7073321 - 7073178
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||| || ||||| || ||||| || || || ||||||||  | |||| ||| || ||     
T  7073321 atcacatttgagatcagacctgaaccttggaggcaacggatcaggcgggggcttaccttgtctagtcgtacaatgccctctttggagtaaagttggaagc 7073222  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| |||||||||||||||| ||| |||||    
T  7073221 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 7073178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 101
Target Start/End: Complemental strand, 51782111 - 51782052
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 101  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51782111 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51782052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 4346836 - 4346969
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  4346836 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 4346935  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  4346936 agttctgcatacaacattggtataggaggaaaag 4346969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 48466036 - 48465903
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  48466036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctttggagtaaagttggaaga 48465937  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  48465936 agttctgcatacaacattggtataggaggaaaag 48465903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 5013800 - 5013688
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  5013800 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 5013701  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  5013700 ataggaggaaaag 5013688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 18242827 - 18242715
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  18242827 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 18242728  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  18242727 ataggaggaaaag 18242715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 5596527 - 5596574
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  5596527 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 5596574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 101
Target Start/End: Complemental strand, 51797192 - 51797141
Alignment:
Q  50 gaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 101  Q
    |||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51797192 gaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51797141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 20577039 - 20577129
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  20577039 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 20577129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 29665162 - 29665252
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  29665162 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 29665252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 8211847 - 8211714
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  8211847 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 8211748  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  8211747 agttctgcatacaacattggtataggaggaaaag 8211714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 22871005 - 22871138
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22871005 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22871104  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  22871105 agttctgcatacaacattggtataggaggaaaag 22871138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 22886064 - 22886197
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22886064 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22886163  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  22886164 agttctgcatacaacattggtataggaggaaaag 22886197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 28021384 - 28021251
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||| || |||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28021384 atcacatttgagatcagacctgaaccttggaggtaatggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtatagttggaaga 28021285  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  28021284 agttctgcatacaacattggtataggaggaaaag 28021251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 48)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 22888634 - 22888499
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22888634 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaaatagagt 22888535  T
Q  114 cgggagtaactcggcatatagcattggtatcggagg 149  Q
    |||||||||||| ||||| | |||||||||||||||    
T  22888534 cgggagtaactcagcatacaacattggtatcggagg 22888499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 148
Target Start/End: Complemental strand, 25199193 - 25199059
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||||||||| |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25199193 gatggaaatcacacttgagatcagaacggaacctgggaggtaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 25199094  T
Q  114 cgggagtaactcggcatatagcattggtatcggag 148  Q
    |||||||||||||||||| | ||||||||||||||    
T  25199093 cgggagtaactcggcatacaacattggtatcggag 25199059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 23892370 - 23892232
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23892370 gatggaaatcacatttgaggtcggaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 23892271  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||| || ||||||||||| |  |||||||||||||||||    
T  23892270 cggaagcaactcggcatacatgattggtatcggaggaaa 23892232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 13184646 - 13184784
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13184646 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13184745  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  13184746 cgggagtaattcagcatataacattggtatcagaggaaa 13184784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 33877411 - 33877273
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33877411 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33877312  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  33877311 cgggagtaattcagcatataacattggtatcagaggaaa 33877273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 11325958 - 11325820
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  11325958 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 11325859  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  11325858 cgggagtaattcagcatataacattggtatcagaggaaa 11325820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 13440492 - 13440630
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13440492 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13440591  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| |  ||||||| |||||||||| |||||||    
T  13440592 cgggagtaatttagcatataacattggtatcagaggaaa 13440630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 29889080 - 29889218
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||  ||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  29889080 gatggaaatcacatatgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggtggtgcagtgccctctgagaagtagagt 29889179  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
     ||||||| ||| ||||| | |||||||||| |||||||    
T  29889180 tgggagtagctcagcatacaacattggtatcagaggaaa 29889218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 23752455 - 23752598
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  23752455 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 23752554  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  23752555 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23752598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 11549490 - 11549368
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  11549490 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 11549391  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  11549390 atcggagggaaagtaggtctagc 11549368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 23718014 - 23718136
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  23718014 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 23718113  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  23718114 atcggagggaaagtaggtctagc 23718136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 30934769 - 30934647
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  30934769 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 30934670  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  30934669 atcggagggaaagtaggtctagc 30934647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 2511187 - 2511065
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  2511187 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 2511088  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  2511087 atcggagggaaagtaggcctagc 2511065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 8665501 - 8665623
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  8665501 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 8665600  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  8665601 atcggagggaaagtaggcctagc 8665623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 15758883 - 15759005
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15758883 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 15758982  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  15758983 atcggagggaaagtaggcctagc 15759005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 24688183 - 24688305
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| |  || |||    
T  24688183 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaatatcggt 24688282  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  24688283 atcggagggaaagtaggtctagc 24688305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 24970154 - 24970032
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  24970154 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 24970055  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  24970054 atcggagggaaagtaggtctagc 24970032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 6874462 - 6874319
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  6874462 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 6874363  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    | ||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  6874362 agctcagcatataacatcggtatcggagggaaagtaggcctagc 6874319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 33777644 - 33777501
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  33777644 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 33777545  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  33777544 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 33777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 26480528 - 26480406
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26480528 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26480429  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  26480428 atcggagggaaagtaggcctagc 26480406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 37671488 - 37671621
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || |||||||| |||||  | |||| ||| || ||     
T  37671488 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 37671587  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  37671588 aactcagcatacaacattggtataggaggaaaag 37671621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 31431576 - 31431464
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  31431576 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 31431477  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  31431476 ataggaggaaaag 31431464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 9548548 - 9548691
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||||||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  9548548 atcacacttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 9548647  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    || || ||||||| ||| ||||||||||| |||| ||| |||||    
T  9548648 aattcagcatataacatcggtatcggagggaaagtaggtctagc 9548691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 22999119 - 22999262
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||||||||| || ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || ||     
T  22999119 atcacacttgagatcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagc 22999218  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  22999219 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 22999262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 5638046 - 5637924
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5638046 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 5637947  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  5637946 atcggagggaaagtaggcctagc 5637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 9317587 - 9317465
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9317587 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9317488  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  9317487 atcggagggaaagtaggcctagc 9317465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 12132291 - 12132169
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12132291 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 12132192  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  12132191 atcggagggaaagtaggcctagc 12132169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 30152154 - 30152032
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30152154 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30152055  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  30152054 atcggagggaaagtaggcctagc 30152032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 30168605 - 30168483
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30168605 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30168506  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  30168505 atcggagggaaagtaggcctagc 30168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 18500735 - 18500868
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  18500735 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtaaagttggaagc 18500834  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||||| ||| ||||| ||||||||||    
T  18500835 aactcagcatataacatcggtataggaggaaaag 18500868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 28649392 - 28649259
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  28649392 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagc 28649293  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  28649292 aactcagcatacaacattggtataggaggaaaag 28649259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 31826433 - 31826545
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  31826433 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 31826532  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  31826533 ataggaggaaaag 31826545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 34616654 - 34616542
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  34616654 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 34616555  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  34616554 ataggaggaaaag 34616542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 15658765 - 15658908
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  15658765 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 15658864  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||| ||||| |||| ||| |||||    
T  15658865 aactcagcatataacatcggtattggagggaaagtaggtctagc 15658908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 41674866 - 41674723
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41674866 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 41674767  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    || || ||||||| ||| ||||||||||| |||| ||| |||||    
T  41674766 aattcagcatataacatcggtatcggagggaaagtaggtctagc 41674723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 37770992 - 37771125
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| ||| || ||     
T  37770992 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagttggaagc 37771091  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  37771092 aactcagcatacaacattggtataggaggaaaag 37771125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 28959812 - 28959924
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  28959812 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 28959911  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  28959912 ataggaggaaaag 28959924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 37358669 - 37358781
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  37358669 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttccgcatacaacattggt 37358768  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  37358769 ataggaggaaaag 37358781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 18375438 - 18375560
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  18375438 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 18375537  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  18375538 ataggaggaaaagtaggtctagc 18375560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 32599477 - 32599610
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  32599477 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 32599576  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  32599577 agttctgcatacaacattggtataggaggaaaag 32599610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 43078409 - 43078276
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || || || ||||||||  | |||||||| || ||     
T  43078409 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtacaatgccctctctggagtagagttggaaga 43078310  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  43078309 agttctgcatacaacattggtataggaggaaaag 43078276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 3789677 - 3789565
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || |  || ||||| | |||||||    
T  3789677 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 3789578  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  3789577 ataggaggaaaag 3789565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 37755116 - 37755004
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  37755116 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgacctctctggagtaaagttggaagcaactcagcatacaacattggt 37755017  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  37755016 ataggaggaaaag 37755004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 33516492 - 33516445
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  33516492 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 33516445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 24681554 - 24681464
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  24681554 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 24681464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Complemental strand, 24724081 - 24723991
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  24724081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 24723991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 154
Target Start/End: Original strand, 40473597 - 40473687
Alignment:
Q  64 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||    
T  40473597 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaag 40473687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 154
Target Start/End: Complemental strand, 33292681 - 33292549
Alignment:
Q  22 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 121  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  33292681 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 33292582  T
Q  122 actcggcatatagcattggtatcggaggaaaag 154  Q
     ||| ||||| | ||||||||| ||||||||||    
T  33292581 gctctgcatacaacattggtataggaggaaaag 33292549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 2759 - 2897
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  2759 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 2858  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
     ||||||| ||||||||||||||||||||||||||||||    
T  2859 tgggagtagctcggcatatagcattggtatcggaggaaa 2897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 45)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 22456978 - 22457116
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22456978 gatggaaatcacacttgaggtaagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccttatgagaagtagagt 22457077  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||| | |||||||||| |||||||    
T  22457078 cgggagtaactcggcatacatcattggtatcagaggaaa 22457116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 22477317 - 22477455
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22477317 gatggaaatcacacttgaggttagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccatatgagaagtagagt 22477416  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||||||||||| | |||||||||| |||||||    
T  22477417 cgggagtaactcggcatacatcattggtatcagaggaaa 22477455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 27290414 - 27290552
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  27290414 gatggaaatcacacttgaggtcagaacggaacttgggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 27290513  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| ||||||| |||||||||| |||||||    
T  27290514 cgggagcaactcagcatataacattggtatcagaggaaa 27290552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 8892354 - 8892492
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8892354 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8892453  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  8892454 cgggagtaattcagcatataacattggtatcagaggaaa 8892492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 8903589 - 8903727
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8903589 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8903688  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  8903689 cgggagtaattcagcatataacattggtatcagaggaaa 8903727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 13522117 - 13522255
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13522117 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13522216  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  13522217 cgggagtaattcagcatataacattggtatcagaggaaa 13522255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 14143329 - 14143467
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  14143329 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 14143428  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  14143429 cgggagcaactcagcatatagcattggtatcagaggaaa 14143467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 26788096 - 26787958
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  26788096 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 26787997  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  26787996 cgggagcaactcagcatatagcattggtatcagaggaaa 26787958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 27196469 - 27196331
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27196469 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27196370  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  27196369 cgggagcaactcagcatatagcattggtatcagaggaaa 27196331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 27252771 - 27252909
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27252771 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27252870  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  27252871 cgggagcaactcagcatatagcattggtatcagaggaaa 27252909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 33374300 - 33374438
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33374300 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33374399  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  33374400 cgggagtaattcagcatataacattggtatcagaggaaa 33374438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 28162809 - 28162671
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| | ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28162809 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaagtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 28162710  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  28162709 cgggagtaattcagcatataacattggtatcagaggaaa 28162671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 20160851 - 20160715
Alignment:
Q  16 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 115  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  20160851 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 20160752  T
Q  116 ggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||| ||||||| ||| ||||||||||||||    
T  20160751 ggagtaactcagcatataacatcggtatcggaggaaa 20160715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 152
Target Start/End: Original strand, 22171980 - 22172116
Alignment:
Q  16 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 115  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  22171980 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 22172079  T
Q  116 ggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||||||| ||||||| ||| ||||||||||||||    
T  22172080 ggagtaactcagcatataacatcggtatcggaggaaa 22172116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 164
Target Start/End: Original strand, 22934924 - 22935074
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  22934924 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 22935023  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||| || ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  22935024 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 22935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 164
Target Start/End: Original strand, 23857369 - 23857519
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  23857369 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 23857468  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||| || ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  23857469 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 23857519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 14 - 154
Target Start/End: Original strand, 27272624 - 27272764
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||   ||||||||||||| |||||| |||||| ||||| |||||||||||||| || ||||||||  | ||||||||    
T  27272624 gatggaaatcacatttgaggtcggacctgaacctgggaggcgacggatcaggtgggggcttaccctgtctggttgtacaatgccctctctggagtagagt 27272723  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaaag 154  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||    
T  27272724 cggaagcaactcagcatataacatcggtatcggagggaaag 27272764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 26918525 - 26918382
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  26918525 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 26918426  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||| | ||| ||||||||||| |||| ||| |||||    
T  26918425 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 26918382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 13299023 - 13299145
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  13299023 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 13299122  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  13299123 atcggagggaaagtaggtctagc 13299145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 24304690 - 24304812
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  24304690 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 24304789  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  24304790 atcggagggaaagtaggtctagc 24304812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 26989125 - 26989003
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  26989125 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 26989026  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  26989025 atcggagggaaagtaggtctagc 26989003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 16749999 - 16749856
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16749999 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 16749900  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  16749899 aactcagcatataacatcggtatcggagggaaagtaggtctagc 16749856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 15424389 - 15424511
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  15424389 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 15424488  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  15424489 atcggagggaaagtaggtctagc 15424511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 24863841 - 24863719
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24863841 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24863742  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  24863741 atcggagggaaagtaggtctagc 24863719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 27000197 - 27000075
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  27000197 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 27000098  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  27000097 atcggagggaaagtaggtctagc 27000075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 4525410 - 4525298
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||||| || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4525410 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4525311  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  4525310 ataggaggaaaag 4525298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 29549620 - 29549487
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  29549620 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 29549521  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||||||||| ||||||||||    
T  29549520 agctctgcatacaacattggtataggaggaaaag 29549487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 3696205 - 3696093
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3696205 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 3696106  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  3696105 ataggaggaaaag 3696093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 4545847 - 4545959
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  4545847 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 4545946  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  4545947 ataggaggaaaag 4545959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 4724206 - 4724318
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  4724206 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 4724305  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  4724306 ataggaggaaaag 4724318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 4773130 - 4773018
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4773130 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4773031  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  4773030 ataggaggaaaag 4773018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 28207578 - 28207466
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  28207578 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 28207479  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  28207478 ataggaggaaaag 28207466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 16674284 - 16674151
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  16674284 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 16674185  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||||||||| ||||||||||    
T  16674184 agctctgcatacaacattggtataggaggaaaag 16674151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 34463397 - 34463530
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| || ||||| || |||||||| |||||  | |||| ||| || ||     
T  34463397 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggctttccttgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 34463496  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||||| ||| ||||| ||||||||||    
T  34463497 aactcagcatataacatcggtataggaggaaaag 34463530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 4757888 - 4757776
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4757888 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4757789  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  4757788 ataggaggaaaag 4757776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 29573137 - 29573025
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| ||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  29573137 gaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 29573038  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  29573037 ataggaggaaaag 29573025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 27007872 - 27007739
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  27007872 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 27007773  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||||||||| ||||||||||    
T  27007772 agttctgcatacaacattggtataggaggaaaag 27007739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 27044532 - 27044399
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  27044532 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaaga 27044433  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||| ||||| ||||||||||    
T  27044432 agctctgcatacaacataggtataggaggaaaag 27044399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 27485253 - 27485141
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  27485253 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 27485154  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  27485153 ataggaggaaaag 27485141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 26777687 - 26777734
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  26777687 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 26777734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 29501539 - 29501492
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  29501539 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 29501492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 30558088 - 30558135
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 89  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  30558088 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30558135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 83
Target Start/End: Original strand, 26116482 - 26116523
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtct 83  Q
    |||||| ||||||||||||| |||||| ||||||||||||||    
T  26116482 gaaccttggaggcaacggatcaggtggtggcttgccctgtct 26116523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 27360064 - 27360176
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27360064 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27360163  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  27360164 ataggaggaaaag 27360176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 27450407 - 27450519
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27450407 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27450506  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  27450507 ataggaggaaaag 27450519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 44563256 - 44563118
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  44563256 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 44563157  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| ||||| |||||||||||||||||| |||||||    
T  44563156 cgggagcaactcagcatatagcattggtatcagaggaaa 44563118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 9354777 - 9354639
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||    
T  9354777 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 9354678  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  9354677 cgggagtaattcagcatataacattggtatcagaggaaa 9354639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 19659099 - 19659237
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  19659099 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 19659198  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| || ||||||| |||||||||| |||||||    
T  19659199 cgggagtaattcagcatataacattggtatcagaggaaa 19659237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 14 - 152
Target Start/End: Original strand, 22080938 - 22081076
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  22080938 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggctttccctgcctggttgtgcagtgccctttgagaagcaaagt 22081037  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| | |||||| || ||||||||||||||||||||    
T  22081038 cgggagcagctcggcgtacagcattggtatcggaggaaa 22081076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 33244820 - 33244682
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||||||||||||||| ||| ||||| | |||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  33244820 gatggaaatcacacttgaggtccgaacggaacttaggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 33244721  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    ||||||||| ||  |||||| |||||||||| |||||||    
T  33244720 cgggagtaattcaacatataacattggtatcagaggaaa 33244682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 16283604 - 16283469
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||| || |||| |||    
T  16283604 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctaaggagtaaagt 16283505  T
Q  114 cgggagtaactcggcatatagcattggtatcggagg 149  Q
    ||| || ||||| ||||| | ||| |||||||||||    
T  16283504 cggaagcaactcagcatacaacatcggtatcggagg 16283469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 16277681 - 16277559
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  16277681 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 16277582  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  16277581 atcggagggaaagtaggtctagc 16277559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 31354672 - 31354529
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| |||||||| |||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31354672 atcacatttgagatcagacctgaaccttggaggcaaaggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31354573  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||||||||||| ||| ||||||||||| |||| ||| |||||    
T  31354572 aactcggcatataacatcggtatcggagggaaagtaggcctagc 31354529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 2137347 - 2137469
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  2137347 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 2137446  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  2137447 atcggagggaaagtaggtctagc 2137469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 19688225 - 19688103
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  19688225 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 19688126  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  19688125 atcggagggaaagtaggtctagc 19688103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 27608993 - 27609115
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  27608993 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 27609092  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  27609093 atcggagggaaagtaggtctagc 27609115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 14557751 - 14557629
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| ||| |  |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  14557751 gaaccttggaggcaacggatcaggcgagggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacattggt 14557652  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  14557651 atcggagggaaagtaggtctagc 14557629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 19208448 - 19208570
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  19208448 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 19208547  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  19208548 atcggagggaaagtaggcctagc 19208570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 31489838 - 31489960
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  31489838 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 31489937  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  31489938 atcggagggaaagtaggcctagc 31489960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 19674589 - 19674446
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  19674589 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 19674490  T
Q  121 aactcggcatatagcattggtatcggaggaaaaggagggctagc 164  Q
    ||||| ||||||| ||| ||||||||||| |||| ||| |||||    
T  19674489 aactcagcatataacatcggtatcggagggaaagtaggcctagc 19674446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 28362043 - 28362165
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28362043 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28362142  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  28362143 atcggagggaaagtaggcctagc 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 3329595 - 3329707
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3329595 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 3329694  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  3329695 ataggaggaaaag 3329707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 18710734 - 18710601
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||||||||| |||||   |||||| ||||||| ||||| |||||  ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18710734 atcacacttgagatcagacctgaaccttggaggcagcggatcaggtgagggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18710635  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    ||||| ||||| | ||||||||| ||||||||||    
T  18710634 aactcagcatacaacattggtataggaggaaaag 18710601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 12092812 - 12092924
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  12092812 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttccgcatacaacattggt 12092911  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  12092912 ataggaggaaaag 12092924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 101
Target Start/End: Complemental strand, 29829450 - 29829390
Alignment:
Q  41 ggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 101  Q
    ||||||| ||||||||||||| |||||| ||||| ||||||||||| || || ||||||||    
T  29829450 ggaaccttggaggcaacggatcaggtgggggcttaccctgtctggtggtacaatgccctct 29829390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 19286610 - 19286477
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  19286610 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 19286511  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    | ||| ||||| | ||| ||||| ||||||||||    
T  19286510 agctctgcatacaacataggtataggaggaaaag 19286477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 21716 - 21578
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 113  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||||| | |||    
T  21716 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacaggttaggtggaggcttgccctgcctggttgtgcagtgtcctttgagaagcaaagt 21617  T
Q  114 cgggagtaactcggcatatagcattggtatcggaggaaa 152  Q
    |||||| | ||||||||||||||||||||||||||||||    
T  21616 cgggagcagctcggcatatagcattggtatcggaggaaa 21578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 2018 - 2103
Alignment:
Q  14 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccct 99  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  2018 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccct 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 101
Target Start/End: Complemental strand, 6160 - 6080
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 101  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||    
T  6160 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctct 6080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 27419 - 27297
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  27419 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 27320  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  27319 atcggagggaaagtaggtctagc 27297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 29890 - 29768
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  29890 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 29791  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  29790 atcggagggaaagtaggtctagc 29768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 40198 - 40320
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    ||||||||| |||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  40198 gaacctggggggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 40297  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  40298 atcggagggaaagtaggtctagc 40320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 47114 - 47236
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  47114 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 47213  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  47214 atcggagggaaagtaggtctagc 47236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 9195 - 9317
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9195 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9294  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  9295 atcggagggaaagtaggcctagc 9317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 42 - 164
Target Start/End: Complemental strand, 20142 - 20020
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20142 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 20043  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  20042 atcggagggaaagtaggcctagc 20020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 7368 - 7490
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7368 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7467  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    |||||||| |||| ||| |||||    
T  7468 atcggagggaaagtaggcctagc 7490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 8076 - 7964
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  8076 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 7977  T
Q  142 atcggaggaaaag 154  Q
    || ||||||||||    
T  7976 ataggaggaaaag 7964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 164
Target Start/End: Original strand, 26338 - 26453
Alignment:
Q  49 ggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggag 148  Q
    ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | ||||||||| ||||    
T  26338 ggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggtataggag 26437  T
Q  149 gaaaaggagggctagc 164  Q
    |||||| ||| |||||    
T  26438 gaaaagtaggcctagc 26453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 258 - 381
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact-cggcatatagcattgg 140  Q
    |||| |||||||||||||||  ||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||   ||||||| ||| ||    
T  258 gaacttgggaggcaacggatccggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactaaagcatataacatcgg 357  T
Q  141 tatcggaggaaaaggagggctagc 164  Q
    ||||||||| |||| ||| |||||    
T  358 tatcggagggaaagtaggtctagc 381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 164
Target Start/End: Original strand, 15059 - 15181
Alignment:
Q  42 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 141  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  15059 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 15158  T
Q  142 atcggaggaaaaggagggctagc 164  Q
    || |||||||||| ||| |||||    
T  15159 ataggaggaaaagtaggtctagc 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 9714 - 9581
Alignment:
Q  21 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 120  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  9714 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaaga 9615  T
Q  121 aactcggcatatagcattggtatcggaggaaaag 154  Q
    |  || ||||| | ||| ||||| ||||||||||    
T  9614 agttctgcatacaacataggtataggaggaaaag 9581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University