View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_347 (Length: 233)
Name: NF10261A_low_347
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_347 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 5750390 - 5750168
Alignment:
| Q |
11 |
ctacgttaattgaccaatttaatttagagtcttcaagttcaaattagttgatttttgtgacctcttggttaatttactcatgtaataatcttggttttat |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750390 |
ctacgttaattgacaaatttaatttagagtcttcaagttcaaattagttgatttttgtgacctcttggttaatttactcatgtaataatcttggttttat |
5750291 |
T |
 |
| Q |
111 |
tatcttcgtttgttttggttagctatgttaaatactttattcttcaattttaggtgttgtgtgtatatgcatgtgcaaatggtagtatggtatatattaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750290 |
tatcttcgtttgttttggttagctatgttaaatactttattcttcaattttaggtgttgtgtgtatatgcatgtgcaaatggtagtatggtatatattaa |
5750191 |
T |
 |
| Q |
211 |
ttgagtccaccttgatttatatt |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5750190 |
ttgagtccaccttgatttatatt |
5750168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University