View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_360 (Length: 230)
Name: NF10261A_low_360
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_360 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 55654467 - 55654648
Alignment:
| Q |
19 |
aatatcaaacacactcttgtatatattgaccaatttgaatccgctataagattaatttttgagttaacgatcgctaatactatatcttccaaatgtgcga |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
55654467 |
aatatcaaacacactctcgtatatattgaccaatttaaatccactataagattaatttttaagttaacgatcgttag-actatatcttccaaatgtgcga |
55654565 |
T |
 |
| Q |
119 |
ctccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55654566 |
ctccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
55654648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University