View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_368 (Length: 230)
Name: NF10261A_low_368
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_368 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 25 - 225
Target Start/End: Original strand, 6307177 - 6307377
Alignment:
| Q |
25 |
ttattgactatgtgaatgtaaacaatatctaaccgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307177 |
ttattgactatgtgaatgtaaacaatatctaactgcacaaaactgtttctcattagagttcaatgaacttggctaagtaatgataaaaagttatacatac |
6307276 |
T |
|
| Q |
125 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtact |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307277 |
tttcaaacccccgtgcacatctttcactcattttgttcttggatcatgtatacctataaaattgcagacaaagaaatcaacttcttacctttcctgtact |
6307376 |
T |
|
| Q |
225 |
t |
225 |
Q |
| |
|
| |
|
|
| T |
6307377 |
t |
6307377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University