View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_371 (Length: 230)
Name: NF10261A_low_371
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_371 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 202
Target Start/End: Complemental strand, 40866414 - 40866236
Alignment:
| Q |
24 |
attagccaacatagacaagcagagacgtttaattatcagagtcatttgacctttgctcacctaacaggtaggttaaatcaaattttgagttgtactgaat |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866414 |
attagccaacatagacaagcagagacatttaattatcagagtcatttgacctttgctcacctaacaggtaggttaaatcaaattttgagttgtactgaat |
40866315 |
T |
 |
| Q |
124 |
tgaaaatatgaagtacatggcttggcacacaagtaattgaaagagttaggcccttctgcactttgatgatcttttctat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40866314 |
tgaaaatatgaagtacatggcttggcacacaagtaattggaagagttaggcccttctgcactttgatgatcttatctat |
40866236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University