View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_373 (Length: 230)
Name: NF10261A_low_373
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_373 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 7 - 124
Target Start/End: Complemental strand, 34590053 - 34589936
Alignment:
| Q |
7 |
gtaactcgtcaattgtcatcgtagttgcatcattcaattcttctattgagaaaacaacataattaaatctttatgttaaagatcttagaatcttttcaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590053 |
gtaactcgtcaattgtcatcgtagttgcatcattcaattcttctattgagaaaacaacataattaaatctttatgttaaagatcttagaatcttttcaac |
34589954 |
T |
 |
| Q |
107 |
agtggttacatgggtcaa |
124 |
Q |
| |
|
| |||||| ||||||||| |
|
|
| T |
34589953 |
aatggttatatgggtcaa |
34589936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 123 - 223
Target Start/End: Complemental strand, 34589890 - 34589790
Alignment:
| Q |
123 |
aagtattcctttagagattcatcaatcttcatgctaagattctcaaattcttcgcatagagctcgaagttgatctctcttcaccttattagaacattgat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34589890 |
aagtattcctttagagattcatcaatcttcatgctaagattctcaaattcttcgcatagagctcgaagttgatctctcttcaccttattagaacattgat |
34589791 |
T |
 |
| Q |
223 |
a |
223 |
Q |
| |
|
| |
|
|
| T |
34589790 |
a |
34589790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University