View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_403 (Length: 228)
Name: NF10261A_low_403
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_403 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 43896136 - 43895948
Alignment:
| Q |
23 |
tccaagaatatagcgatatacatacttaccgattaagccaaatcaatctaccaagcgtcggtgatattagtcaatttttacaagtttttaccatgcctcc |
122 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43896136 |
tccaaaaatatagcgatatacatacttaccgatctagccaaatcaatctcccaagcgtcggtgatattagtcaatttttacaagtttttaccatgcctcc |
43896037 |
T |
|
| Q |
123 |
agattttannnnnnnnatttataaaaccatatgcctccagatatattagtagatgtctacaaatataattaatttataaaaaatattgatgt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43896036 |
agatttt---tttcttatttataaaaccatatgcctccagatatattagtagatatctacaaatataattaatttataaaaaatattgatgt |
43895948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University