View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_422 (Length: 225)
Name: NF10261A_low_422
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_422 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 26793490 - 26793648
Alignment:
| Q |
18 |
atatattcctcagattaatgtgtaccttgaagtattcgtttactaatgcttcttttcttttcaatnnnnnnngtttaagcgcacttgatttctcgact-- |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26793490 |
atatattcctcagattaatgtgtaccttgaagtattcgttttctaatgcttcttttcttttcaataaaaaaagtttaagcgcacttgatttctcgactac |
26793589 |
T |
|
| Q |
116 |
actttaattaacaaaagctaaaactaagttccactaggcctagcctttcaaaaacctat |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26793590 |
actttaattaacaaaagctaaaactaagttccactaggcctagcctttcaaaaacctat |
26793648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University