View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_424 (Length: 224)
Name: NF10261A_low_424
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_424 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 42444480 - 42444253
Alignment:
| Q |
1 |
tatatttttgaagtgcttgtctcagtactccgagcggtagggtgcagttcacttccttgagtaaaatgaatatggaaactcaacacgaaagtgagagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444480 |
tatatttttgaagtgcttgtctcagtactccgagcggtagggtgcagttcacttccttgagtaaaatgaatatggaaactcaacacgaaagtgagagcaa |
42444381 |
T |
|
| Q |
101 |
tgaaaaggaaataatccatgttcaagagaaactttactttctgcttgatggaagaatgaaagaggtgtgctcta----aatacattcacaatgattatat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
42444380 |
tgaaaaggaaataatccatgttcaagagaaactttactttctgcttgatggaagaatgaaagaagtgtgctctaaataaatacattcacaatgattatat |
42444281 |
T |
|
| Q |
197 |
atttatatgtaactttgtaagtaacact |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42444280 |
atttatatgtaactttgtaagtaacact |
42444253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University