View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_429 (Length: 222)

Name: NF10261A_low_429
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_429
NF10261A_low_429
[»] chr5 (3 HSPs)
chr5 (20-167)||(40456640-40456787)
chr5 (105-167)||(40482086-40482148)
chr5 (20-72)||(40362953-40363005)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 40456787 - 40456640
Alignment:
20 atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtacatatgtgg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
40456787 atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtatatatgtgg 40456688  T
120 tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
40456687 tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt 40456640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 105 - 167
Target Start/End: Complemental strand, 40482148 - 40482086
Alignment:
105 tctgtacatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt 167  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40482148 tctgtatatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt 40482086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 40362953 - 40363005
Alignment:
20 atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatctt 72  Q
    |||| |||||||||||||||||||||| |||||||| ||| ||||| ||||||    
40362953 atcaaatgtgataccaattagtccttgcacaaatgataactagaagaaatctt 40363005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University