View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_430 (Length: 222)
Name: NF10261A_low_430
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_430 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 23840408 - 23840617
Alignment:
| Q |
15 |
aagaaacaaagatacggagcacaggtttaaataaagatttatgacagctatgtaggctgtgacataacggttgcatcagttatatctaatcgcgattcta |
114 |
Q |
| |
|
||||||||| ||| |||||| |||||||||||||| || ||||||||| ||| |||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
23840408 |
aagaaacaacaatagggagcaacggtttaaataaagacttgcgacagctatctagcttgtgacataatggttgcatcagttatatctaaccgcgattcta |
23840507 |
T |
|
| Q |
115 |
cacaatattaaggatcgcaacacaaagacaacccgttatacgaagtacaaagactaaaaaagacact--gnnnnnnngttaccttgtcatcgatgaattt |
212 |
Q |
| |
|
| ||||||||||||||||||||| |||||||| |||||| |||||||| | ||||||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
23840508 |
cgcaatattaaggatcgcaacacgaagacaacgtgttataggaagtacatatactaaaaaaaatactaaaagaagaagttaccttgtcatcgatgaattt |
23840607 |
T |
|
| Q |
213 |
cgaccaaaat |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
23840608 |
cgaccaaaat |
23840617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 222
Target Start/End: Original strand, 23861237 - 23861268
Alignment:
| Q |
191 |
ttaccttgtcatcgatgaatttcgaccaaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23861237 |
ttaccttgtcatcgatgaatttcgaccaaaat |
23861268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Original strand, 23844033 - 23844065
Alignment:
| Q |
190 |
gttaccttgtcatcgatgaatttcgaccaaaat |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
23844033 |
gttaccttgtcatcgatgaattttgaccaaaat |
23844065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University