View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_441 (Length: 221)
Name: NF10261A_low_441
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_441 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 174
Target Start/End: Original strand, 19592575 - 19592733
Alignment:
| Q |
16 |
atggtgttatccacattgaagagcgatatcgtggtgggatgaaactttgttccatattagaatgggatgatcgtggtggttccgacgaatatggtgtaat |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19592575 |
atggtgttatccacgttgaagagcgatatcgtggtgggatgaaactttgttccatattagaatgggatgatcgtggtgtttccgacgaatatggtgtaat |
19592674 |
T |
|
| Q |
116 |
agaataatatggtggtcgtgctggctgcgatgaagaagatcgttgaaaagaatagtgtg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19592675 |
agaataatatggtggtcgtgctggctgcgatgaagaagatcgttgaaaagaatagtgtg |
19592733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University