View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_446 (Length: 219)
Name: NF10261A_low_446
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_446 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 18540357 - 18540160
Alignment:
| Q |
13 |
ttggtgtttatgatgtaccatgtatgtttcttttgagtgttttgctatatactacgccttttgctatataatttttgtcttgctggtctctgttcgcctc |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18540357 |
ttggtgtttatgatgtactgtgtatgtttcttttgagtgttttgctatatatgacgccttttgctatataatttttgtcttgctggtctctgttcgcctc |
18540258 |
T |
|
| Q |
113 |
aacaaggacttggttattataaatctgtcattcnnnnnnnnnnnngtatgatattcattttcactctgttgcataaatatgatattgatgtccatctcat |
212 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18540257 |
ggcaaggacttggttattataaatttgtcgat--aaaaaaaaaaagtatgatattcattttcactctgttgcataaatatgatatttatgtccatctcat |
18540160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University