View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_449 (Length: 219)
Name: NF10261A_low_449
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_449 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 202
Target Start/End: Complemental strand, 32781120 - 32780932
Alignment:
| Q |
14 |
catgaccgaaattcctggagctggttgacgacaatggagaagccgtattcgtttctgttccaaggtagtctgcccatctagatggaccatcccattccct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781120 |
catgaccgaaattcctggagctggttgacgacaatggagaagccgtatttgtttctgttccaaggtagtctgcccatctagatggaccatcccattccct |
32781021 |
T |
 |
| Q |
114 |
tgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtctctg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781020 |
tgatcttgccgcagtcggcgataatgaagaatcctggttcgatgatttttgcctcgacttcgccataaactaataataatccgtctctg |
32780932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University