View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_457 (Length: 216)
Name: NF10261A_low_457
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_457 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 194
Target Start/End: Original strand, 31457787 - 31457962
Alignment:
| Q |
22 |
gaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatccccaccaccactgcc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31457787 |
gaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctccaggtgctttcattgaatccccaccaccactgcc |
31457886 |
T |
|
| Q |
122 |
accggtggaccctttgcttcc---accgccgcctccttttgcgccacctccaccaccaccttttgaaccaccgcta |
194 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31457887 |
accggtggaccctttgcttccggtaccaccgcctccttttgcgccacctccaccaccaccttttgcaccaccgcta |
31457962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 22 - 178
Target Start/End: Original strand, 49085736 - 49085892
Alignment:
| Q |
22 |
gaccactaaaatagccttgagggttgttttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatccccaccaccactgcc |
121 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49085736 |
gaccaccaaaatagccttgtgggttgctttcaaatgcaccacgagatatgtatgatccaccacctcccggtgctttcattgaatctccaccaccactgcc |
49085835 |
T |
|
| Q |
122 |
accggtggaccctttgcttccaccgccgcctccttttgcgccacctccaccaccacc |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
49085836 |
accggtggaccctttgcttccaccaccgcctccttttgtgccacctcctccaccacc |
49085892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University