View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_458 (Length: 215)
Name: NF10261A_low_458
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_458 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 4 - 215
Target Start/End: Original strand, 3103546 - 3103757
Alignment:
| Q |
4 |
tttggtgttcttttgctagagatcatcagtggaagaaaaaacagtaaattctatctttcatagcatgggcaaagccttcccatatttttaggtttcataa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3103546 |
tttggtgttcttttgctagagatcatcagtggaagaaaaaacagtaaattctatctttcagagcatgggcaaagccttcccatatttgtaggtttcataa |
3103645 |
T |
|
| Q |
104 |
tcttatgcttgcannnnnnnncttaagaaaaaacaatatgattataactaaaatgaaataaatgtataattataggcatggaacctttggtgtaaaagaa |
203 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3103646 |
tcttatacttgcattttttttcttaagaaaaaacaatatgattataactaaaatgaaataaatgtataattataggcatggaacctttggtgtaaaagaa |
3103745 |
T |
|
| Q |
204 |
aaggcttcgaac |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3103746 |
aaggcttcgaac |
3103757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 4 - 99
Target Start/End: Original strand, 3123077 - 3123172
Alignment:
| Q |
4 |
tttggtgttcttttgctagagatcatcagtggaagaaaaaacagtaaattctatctttcatagcatgggcaaagccttcccatatttttaggtttc |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||| | ||||||||||||| ||||||| |||||||||| || || | |||||||| |
|
|
| T |
3123077 |
tttggcgttcttttgctagagatcatcagtggaaaaaggaacaacagattctatctttcagagcatggccaaagccttctcacatatgtaggtttc |
3123172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 4 - 99
Target Start/End: Complemental strand, 3132771 - 3132676
Alignment:
| Q |
4 |
tttggtgttcttttgctagagatcatcagtggaagaaaaaacagtaaattctatctttcatagcatgggcaaagccttcccatatttttaggtttc |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||| ||||||||||||||| ||||||| ||||| |||| || || | |||||||| |
|
|
| T |
3132771 |
tttggcgttcttttgctagagatcatcagtggaaaaaggaacaacaaattctatctttcagagcatggccaaagtcttctcacatatgtaggtttc |
3132676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University