View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_459 (Length: 214)
Name: NF10261A_low_459
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_459 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 6416347 - 6416497
Alignment:
| Q |
19 |
acatatgtcgtcttgttcattccaaaccttaaacttagcggatgcaacagtagctatcaatcctcaagaagcaaacaaaaagtttcgtgacagtagtggc |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
6416347 |
acatatgtcgtcttgttcattctaaaccttaaacttagcggatgcaacagtagccatcagtcctcacgaagcaaacaacaagtatcgtgacagtagtggc |
6416446 |
T |
|
| Q |
119 |
ggggaacaatgtggcaacattgaattcaccgcaagtgcaattgcaacgccc |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6416447 |
ggggaacaatgtggcaacattgaattcaccgcaagtgcaattgcaacgccc |
6416497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 6379186 - 6379148
Alignment:
| Q |
167 |
ccccttttggttgctctagtcacacttcttagtctatga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6379186 |
ccccttttggttgctctagtcacacttcttagcctatga |
6379148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University