View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_464 (Length: 212)
Name: NF10261A_low_464
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_464 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 2906165 - 2906376
Alignment:
| Q |
1 |
aaaatcatcattatggtggtgttcttccaccctgccgcccccaacttcatctcccccctccacaactgtgccgaattgaacgccccgccctccaccgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||| |||||||||| ||||||||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
2906165 |
aaaatcatcattatggtggtgttcttcctcgctgccgccaccaaattcatctcccacctccacaactgtgccgaattgaacacgacgctctccaccgccg |
2906264 |
T |
|
| Q |
101 |
cccccaataggggaatgagaaggggattttgtaccacgagggcttctaacagcagtagcagctgtttgtggagattttggtgtccaaattgcaccagtat |
200 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2906265 |
ccaccaacaggggaatgagaaggggattttgtaccacgagggcttctaacagcagtagcagctgtttgtggagattttggtgtccaaattgcaccagtat |
2906364 |
T |
|
| Q |
201 |
taccataattgt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2906365 |
taccataattgt |
2906376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 2854137 - 2854348
Alignment:
| Q |
1 |
aaaatcatcattatggtggtgttcttccaccctgccgcccccaacttcatctcccccctccacaactgtgccgaattgaacgccccgccctccaccgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||| |||||||||| ||||||||||||||| |||||||| | | | | |||||||| |
|
|
| T |
2854137 |
aaaatcatcattatggtggtgttcttcctcgctgccgccaccaaattcatctcccatctccacaactgtgccaaattgaacccgacactcctcaccgcca |
2854236 |
T |
|
| Q |
101 |
cccccaataggggaatgagaaggggattttgtaccacgagggcttctaacagcagtagcagctgtttgtggagattttggtgtccaaattgcaccagtat |
200 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2854237 |
ccaccaacaggggaatgagaaggggattttgtaccacgagggcttctaacagcagtagcagctgtttgtggagattttggtgtccaaattgcaccagtat |
2854336 |
T |
|
| Q |
201 |
taccataattgt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2854337 |
taccataattgt |
2854348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University