View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_466 (Length: 211)
Name: NF10261A_low_466
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_466 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 12 - 117
Target Start/End: Original strand, 47116765 - 47116870
Alignment:
| Q |
12 |
agatggacatcactccaagcttcctcatacccttgttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggta |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47116765 |
agatggacaccactccaagcttcctcatacccttgttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggta |
47116864 |
T |
|
| Q |
112 |
attaca |
117 |
Q |
| |
|
|||||| |
|
|
| T |
47116865 |
attaca |
47116870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 109 - 194
Target Start/End: Complemental strand, 11326402 - 11326317
Alignment:
| Q |
109 |
gtaattacataaggtgtgaatattgtctgtctactacagctacacaatcatggaaatatggaattttggttctgcaagataggatg |
194 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11326402 |
gtaataacataaggtgtgagtattgtctgtctactacagctacacaatcatggaaatatggaattttggttctgcaagataggatg |
11326317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 109 - 194
Target Start/End: Complemental strand, 11484423 - 11484338
Alignment:
| Q |
109 |
gtaattacataaggtgtgaatattgtctgtctactacagctacacaatcatggaaatatggaattttggttctgcaagataggatg |
194 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11484423 |
gtaataacataaggtgtgagtattgtctgtctactacagctacacaatcatggaaatatggaattttggttctgcaagataggatg |
11484338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University