View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_472 (Length: 210)
Name: NF10261A_low_472
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_472 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 24 - 147
Target Start/End: Original strand, 10368672 - 10368795
Alignment:
| Q |
24 |
tcatctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcattt |
123 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368672 |
tcatctccttcatcacaacccgtactgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcattt |
10368771 |
T |
 |
| Q |
124 |
cgatctcaccccttatatatatat |
147 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10368772 |
cgatctcaccccttatatatatat |
10368795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 10368827 - 10368869
Alignment:
| Q |
137 |
tatatatatatgcgtgtgtgtgtcttaaggaacaattgtggag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368827 |
tatatatatatgcgtgtgtgtgtcttaaggaacaattgtggag |
10368869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 64 - 137
Target Start/End: Original strand, 11659585 - 11659658
Alignment:
| Q |
64 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccctt |
137 |
Q |
| |
|
|||||||||||| ||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
11659585 |
attgaaaaggacagcaagaacaagaaggaggctactatttcaaggtatgggtttgcatttcgatctcactcctt |
11659658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 64 - 137
Target Start/End: Original strand, 11668754 - 11668827
Alignment:
| Q |
64 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccctt |
137 |
Q |
| |
|
|||||||||||| |||| ||||||||||| | ||||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
11668754 |
attgaaaaggacagcaaaaagaagaaggaggctactatttcaaggtatcggtttgcatttcgatctcactcctt |
11668827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 102
Target Start/End: Original strand, 53239215 - 53239290
Alignment:
| Q |
27 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
102 |
Q |
| |
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
53239215 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
53239290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 102
Target Start/End: Original strand, 2170330 - 2170405
Alignment:
| Q |
27 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
102 |
Q |
| |
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
2170330 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
2170405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University