View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_475 (Length: 210)
Name: NF10261A_low_475
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_475 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 23 - 196
Target Start/End: Original strand, 32891860 - 32892033
Alignment:
| Q |
23 |
aacaaaaaccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaa |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891860 |
aacaaaatccccccacccaacaatagacgtcgaaaagttccaaagagtgcgtttctcttggaacgctatggtccgcaagaattttctaacatgaccagaa |
32891959 |
T |
|
| Q |
123 |
aacttgtctccccatcttccatattgttcatggtttgactccgagtagtactctcaacatcagcaatttgatgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32891960 |
aacttgtctccccatcttccatattgttcatggtttgactccgagtagtaatctcaacatcaacaatttgatgt |
32892033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University