View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_488 (Length: 205)
Name: NF10261A_low_488
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_488 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 6359271 - 6359103
Alignment:
| Q |
17 |
aatatatttaataacgaaataataacagtagtagatagagagaattacaaggacgagcttaaattcaaaatgtctctcgtgtttgcatcaattgatttgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6359271 |
aatatatttaataacgaaataataacagtagtaaatagagagaattacaaggacgagcttaaattcaaaacgtctctcgtgtttgcatcaattgatttgc |
6359172 |
T |
 |
| Q |
117 |
agtttctcaatccttttatatatggatatagcttcttgataatctgcacatactcaaggatctgacttc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6359171 |
agtttctcaatccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc |
6359103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 185
Target Start/End: Original strand, 32857285 - 32857358
Alignment:
| Q |
112 |
tttgcagtttctcaatccttttatatatggatatagcttcttgataatctgcacatactcaaggatctgacttc |
185 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||| ||| ||||| || ||| |||||||| ||||||| |
|
|
| T |
32857285 |
tttgcagtttctcaatcattttatggatggaaatagcttcatgagaatctacatatagtcaaggatttgacttc |
32857358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University