View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_493 (Length: 203)
Name: NF10261A_low_493
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_493 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 45616236 - 45616438
Alignment:
| Q |
1 |
aatatagaagcaaaaccctcataaaccctaaagtaaatctcagtccaaagcataatcacaaaattgagattgaataaattcagattgtaaacaaatgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616236 |
aatatagaagcaaaaccctcataaaccctaaactaaatctcagtccaaattataatcacaaaattgagattgaataaattcagattgtaaacaaatgaac |
45616335 |
T |
|
| Q |
101 |
gggtatagagaatctgacggaaaattaccaaccactccgatacgaattattattccaatttgaaatgtagttctgtcgatgaaaatgaactctgggaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616336 |
gggtatagagaatctgacggaaaattaccaaccactccgatacgaattattattccaatttgaaatgtagttctgtcgatgaaaatgaactctgggaaat |
45616435 |
T |
|
| Q |
201 |
cta |
203 |
Q |
| |
|
||| |
|
|
| T |
45616436 |
cta |
45616438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University