View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_496 (Length: 203)

Name: NF10261A_low_496
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_496
NF10261A_low_496
[»] chr3 (1 HSPs)
chr3 (133-178)||(7779169-7779214)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 133 - 178
Target Start/End: Complemental strand, 7779214 - 7779169
Alignment:
133 cacgtccttctatcctcacttttaattgtgttaacacatagctccc 178  Q
    |||||||||||||||||||||||||||||||||||| |||||||||    
7779214 cacgtccttctatcctcacttttaattgtgttaacaaatagctccc 7779169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University