View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_54 (Length: 384)
Name: NF10261A_low_54
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 12 - 377
Target Start/End: Original strand, 44041178 - 44041543
Alignment:
| Q |
12 |
agttgtggaattggaagaaaggttggtcttgtgatgagacttttgaagggaactcacattatgtgatgcaagtggcatttaatcccaaggatccatctac |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041178 |
agttgtggaattggaaaaaaggttggtcttgtgatgagacttttgaagggaactcacattatgttatgcaagtggcatttaatcccaaggatccatctac |
44041277 |
T |
|
| Q |
112 |
ctttgccagtgcatccctcgatggaactttaaaggtatcttaaccgaaaatcctcaactgtaattcttatggtcaagggctcaaggctagcgtcataatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||| |
|
|
| T |
44041278 |
ctttgccagtgcatccctcgatggaactttaaaggtatcttaaccgaaaatcctcaactgtaattcgtatggtcaagggctcaaggctagcgtgatgatc |
44041377 |
T |
|
| Q |
212 |
ctcgatattattgtggagtgtcgggatcaaatcttgttgatgcaactttctaaaaccctgcttcttactacatgtttcaaaatcattaactaacattttg |
311 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44041378 |
ctcgatataattgtggagtgtcgggatcaaatcttgttgatgcaactttctaaaaccctgcttcttactacatatttcaaaatcattaactaacattttg |
44041477 |
T |
|
| Q |
312 |
taccaatttactgtttttgtagatttggactattgattcctcagctccaaattttacctttgaagg |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041478 |
taccaatttactgtttttgtagatttggactattgattcctcagctccaaattttacctttgaagg |
44041543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University