View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_65 (Length: 371)
Name: NF10261A_low_65
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_65 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 149705 - 149871
Alignment:
| Q |
18 |
atcacaacaatttgttgtaagaggaagtgaaacaaacccttttatttcaactccattatatgtttcaagtggtggtgcaagttcttcaccttttgaaacc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149705 |
atcacaacaaattgttgtaagtggaagtggaacaaacccttttatttcaactccattatatgtttcaagtggtggtgcaagttcttcaccttttgaaacc |
149804 |
T |
|
| Q |
118 |
caatttgaaacatccttaaccacaaaaagaccaagatatagtggacaatggaagctcctaccttcac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
149805 |
caatttgaaacatccttaaccacaaaaagaccaagatatagtggacaatggaagcttctaccttcac |
149871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 301 - 371
Target Start/End: Original strand, 149988 - 150058
Alignment:
| Q |
301 |
ttagctgcttcttcatcagagacaacttcatcacaatctcatgatcattcaccaatgccttgtcaagaagg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149988 |
ttagctgcttcttcatcagagacaacttcatcacaatctcatgatcattcaccaatgccttgtcaagaagg |
150058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University