View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_67 (Length: 368)
Name: NF10261A_low_67
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 30778732 - 30778387
Alignment:
| Q |
1 |
gactgcatggtgcaagtttgtgggttaggttttggcgtctttttgatttacgtttgataaagatgttaccttagtggagattaggaggctagcatggggg |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30778732 |
gactgcatggtgaaggtttgtgggttaggttttggcgtccttttgatttacgtttgataaaggtgttaccttagtggagattaggaggctagcatggggg |
30778633 |
T |
|
| Q |
101 |
attgataggctagggtaaccgtggaagaagacgtctccatgtga-ttagttgtcgggtgtttaaga-gtttggaaggacaagaatagtcgtatttttcga |
198 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30778632 |
attgataggctaggatagcggtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaaggataagaatagtcgtatttttcga |
30778533 |
T |
|
| Q |
199 |
catatagatcaatcgatacagcaaccggtgaacatcgttaagttttcttctttttgatggttacaatcgaaaattaacaacttagccttttattttcatc |
298 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| ||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
30778532 |
catataga-caatcgatacaacaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaacaacttagcttttgattttcatc |
30778434 |
T |
|
| Q |
299 |
atcggtggacaagcaaaaattgcaacttagcttttgattttcatcat |
345 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30778433 |
atcggtggacaagcaaaaattgcaacgtagcttttgattttcatcat |
30778387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University