View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_75 (Length: 357)
Name: NF10261A_low_75
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 340
Target Start/End: Complemental strand, 9545795 - 9545475
Alignment:
| Q |
20 |
gatactcccttgaagaagaagttagacgaatttggtggcaggcttacaacttctattggaatagtttgtcttgttgtttggattataaactacaaaaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9545795 |
gatactcccttgaagaagaagttagacgaatttggtggcaggcttacaacttctattggaatagtttgtcttgttgtttggattataaactacaaaaatt |
9545696 |
T |
 |
| Q |
120 |
tcatatcttgggatgttgttgatggatggcctacaaacattcaattttcttttcagaaatgcacttactatttcaaaattgctgttgctcttgctgcggc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9545695 |
tcatatcttgggatgttgttgatggatggcctacaaacattcaattttcttttcagaaatgcacttactatttcaaaattgctgttgctcttgctgtggc |
9545596 |
T |
 |
| Q |
220 |
tgcaattccagaaggtcttccggcggttattacaacttgtttagcacttggtacaaggaaaatggcacaaaagaatgcaattgtgagaaagcttccaagt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9545595 |
tgcaattccagaaggtcttccggcggttattacaacttgtttagcacttggtacaaggaaaatggcacaaaagaatgcaattgtgagaaagcttccaagt |
9545496 |
T |
 |
| Q |
320 |
gttgaaactttgggatgtacc |
340 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9545495 |
gttgaaactttgggatgtacc |
9545475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University