View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_80 (Length: 355)
Name: NF10261A_low_80
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_80 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 12 - 332
Target Start/End: Original strand, 42455177 - 42455497
Alignment:
| Q |
12 |
tgtttgcccatgttggatcgtgatttattttactcatgagtttattttagttctgggtatatatattcttctagtataatataaatcttcttatggtata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455177 |
tgtttgcccatgttggatcgtgatttattttactcatgagtttattttagttctgggtatatatattcttctagtataatataaatcttcttatggtata |
42455276 |
T |
|
| Q |
112 |
gtgcatgcaagctttcaacgggtgccataagcccttatgtgtcaagtcgggcagtatgcatgagattatgacgggtctatggagcacttataaaaatcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42455277 |
gtgcatgcaagctttcaacgggtgccataagcccttatgtgtaaagtcgggcagtatgcatgagattatgaccggtctatggagcacttataaaaatcat |
42455376 |
T |
|
| Q |
212 |
ataagtctaaatgtgcaacaatgcgataacacgataatcgtgaggttgtgatgtgaatggtagacctcttatctatacgtgtctttggttcatttaactt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455377 |
ataagtctaaatgtgcaacaatgcgataacacgataatcgtgaggttgtgatgtgaatggtagacctcttatctatacgtgtctttggttcatttaactt |
42455476 |
T |
|
| Q |
312 |
gctacactaatttcaatgtat |
332 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42455477 |
gctacactaatttcaatgtat |
42455497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University